SubtiBank SubtiBank
yofA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yofA

transcriptional activator of [gene|8AB7D225DBEE6BD695A4A8A2384D2C029B571C57|ftsW] at the onset of stationary phase
locus
BSU_18420
pI
6.16
mw
31.90 kDa
protein length
285 aa Sequence Blast
gene length
858 bp Sequence Blast
function
control of [gene|8AB7D225DBEE6BD695A4A8A2384D2C029B571C57|ftsW] expression
product
transcriptional activator ([SW|LysR family])
essential
no
synonyms
ftsR

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    2,006,541 2,007,398

    The protein

    Protein family

  • [SW|LysR family] (according to UniProt)
  • Structure

  • [PDB|4X6G] (from Pseudomonas aeruginosa, 25% identity) [pubmed|25931525]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|6FDA046DCBBAE4588C4BC7163A04B9E6AEDBAC55|yofA]
    description
    [Pubmed|22383849]

    regulation

  • maximally expressed at the onset of stationary phase [Pubmed|17526699]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B090 (yofA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1089 NBRP B. subtilis, Japan]
  • BKE18420 ([gene|6FDA046DCBBAE4588C4BC7163A04B9E6AEDBAC55|yofA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGCGCTCTCACCTGCTTG, downstream forward: _UP4_TGAAGATAGACGTGCATTAG
  • BKK18420 ([gene|6FDA046DCBBAE4588C4BC7163A04B9E6AEDBAC55|yofA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGCGCTCTCACCTGCTTG, downstream forward: _UP4_TGAAGATAGACGTGCATTAG
  • References

  • 17526699,22383849,25931525