SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


transcriptional activator of ftsW at the onset of stationary phase
31.90 kDa
protein length
285 aa Sequence Blast
gene length
855 bp Sequence Blast
control of ftsW expression
transcriptional activator (LysR family)

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    2,006,541 → 2,007,398

    The protein

    Protein family

  • [SW|LysR family]
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Expression and Regulation




  • maximally expressed at the onset of stationary phase [Pubmed|17526699]
  • view in new tab

    Biological materials


  • MGNA-B090 (yofA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE18420 (Δ[gene|6FDA046DCBBAE4588C4BC7163A04B9E6AEDBAC55|yofA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGCGCTCTCACCTGCTTG, downstream forward: _UP4_TGAAGATAGACGTGCATTAG
  • BKK18420 (Δ[gene|6FDA046DCBBAE4588C4BC7163A04B9E6AEDBAC55|yofA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGCGCTCTCACCTGCTTG, downstream forward: _UP4_TGAAGATAGACGTGCATTAG
  • References

  • 17526699,22383849