SubtiBank SubtiBank
yofA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yofA

transcriptional activator of [gene|8AB7D225DBEE6BD695A4A8A2384D2C029B571C57|ftsW] at the onset of stationary phase
locus
BSU_18420
pI
6.16
mw
31.90 kDa
protein length
285 aa Sequence Blast
gene length
858 bp Sequence Blast
function
control of [gene|8AB7D225DBEE6BD695A4A8A2384D2C029B571C57|ftsW] expression
product
transcriptional activator ([SW|LysR family])
essential
no
synonyms
ftsR

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    2,006,541 2,007,398

    The protein

    Protein family

  • [SW|LysR family] (according to UniProt)
  • [SW|Domains]

  • [SW|HTH lysR-type domain] (aa 1-58) (according to UniProt)
  • Structure

  • [PDB|4X6G] (from Pseudomonas aeruginosa, 25% identity) [pubmed|25931525]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|6FDA046DCBBAE4588C4BC7163A04B9E6AEDBAC55|yofA]
    description
    [Pubmed|22383849]

    regulation

  • maximally expressed at the onset of stationary phase [Pubmed|17526699]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B090 (yofA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1089 NBRP B. subtilis, Japan]
  • BKE18420 ([gene|6FDA046DCBBAE4588C4BC7163A04B9E6AEDBAC55|yofA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGCGCTCTCACCTGCTTG, downstream forward: _UP4_TGAAGATAGACGTGCATTAG
  • BKK18420 ([gene|6FDA046DCBBAE4588C4BC7163A04B9E6AEDBAC55|yofA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGCGCTCTCACCTGCTTG, downstream forward: _UP4_TGAAGATAGACGTGCATTAG
  • References

  • 17526699,22383849,25931525