SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


thymidylate synthase A
32.65 kDa
protein length
279 aa Sequence Blast
gene length
840 bp Sequence Blast
biosynthesis of thymidine nucleotides
thymidylate synthase A

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • Gene

    1,902,219 1,903,058

    The protein

    Catalyzed reaction/ biological activity

  • (6R)-5,10-methylene-5,6,7,8-tetrahydrofolate + dUMP --> 7,8-dihydrofolate + dTMP (according to UniProt)
  • Protein family

  • thymidylate synthase family (with [protein|9F9643D51E9ABA537892B19312491697CECDDCCF|ThyB], according to UniProt)
  • Paralogous protein(s)

  • [protein|9F9643D51E9ABA537892B19312491697CECDDCCF|ThyB]
  • Structure

  • [PDB|1B02] [pubmed|10091656]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE17680 ([gene|6FE1D3C4D4DF86DE2D3D9A143A1DCFE120F13F5F|thyA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACTATTCATATCCTTC, downstream forward: _UP4_TAATGCTGCCTTTTTATTGT
  • BKK17680 ([gene|6FE1D3C4D4DF86DE2D3D9A143A1DCFE120F13F5F|thyA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACTATTCATATCCTTC, downstream forward: _UP4_TAATGCTGCCTTTTTATTGT
  • References


  • 7574499
  • Original publications

  • 418407,11267663,28700593,10091656,7704257,9648749,111614,29150519