SubtiBank SubtiBank
hemB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

hemB

porphobilinogen synthase
locus
BSU_28130
pI
4.98
mw
36.05 kDa
protein length
324 aa Sequence Blast
gene length
975 bp Sequence Blast
function
heme biosynthesis
product
porphobilinogen synthase
essential
no
ec
4.2.1.24
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.6|Biosynthesis of heme/ siroheme]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    2,874,202 2,875,176

    The protein

    Catalyzed reaction/ biological activity

  • 2 5-aminolevulinate --> porphobilinogen + 2 H2O (according to UniProt)
  • Protein family

  • ALAD family (single member, according to UniProt)
  • Modification

  • phosphorylated on Arg-217 [Pubmed|22517742]
  • [SW|Cofactors]

  • zinc
  • Structure

  • [PDB|1W5Q] (from ''Pseudomonas aeruginosa'', 48% identity) [Pubmed|15644204]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    count
    2
    genes
    [gene|B1413EB525000744BE8E429E760220A13BC4530D|hemA]-[gene|88616BA1E853E11BE0CB18F06287CA4C68143148|hemX]-[gene|D266E22E07B849E2AEB0EF232C49A2FE1EA4E02B|hemC]-[gene|33459D4389F85D60311FCE770BBA0ED9802BA342|hemD]-[gene|70263A55987F110209367CF45AD65A584AD3077D|hemB]-[gene|A54B2C86638D474F5F892003B42C535B5B39A42E|hemL]
    description
    [Pubmed|1672867]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1672867], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: repression, [Pubmed|11532148], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • regulation

  • induced by hydrogen peroxide ([protein|search|PerR]) [Pubmed|11532148]
  • view in new tab

    Biological materials

    Mutant

  • BKE28130 ([gene|70263A55987F110209367CF45AD65A584AD3077D|hemB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCGGTGTCTATTAAATGATT, downstream forward: _UP4_TAATTTTATTCAGTTGACAG
  • BKK28130 ([gene|70263A55987F110209367CF45AD65A584AD3077D|hemB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCGGTGTCTATTAAATGATT, downstream forward: _UP4_TAATTTTATTCAGTTGACAG
  • References

    Reviews

  • 28123057
  • Original Publications

  • 10217486,11532148,1672867,4214010,804803,12926268,20823524,22517742,15644204