SubtiBank SubtiBank
ykcB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ykcB

unknown
locus
BSU_12880
pI
9.53
mw
76.28 kDa
protein length
716 aa Sequence Blast
gene length
2151 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,354,285 1,356,435

    Phenotypes of a mutant

  • poorly transformable [pubmed|28189581]
  • The protein

    Protein family

  • glycosyltransferase 39 family (with [protein|CFEA05E10517C00222126F959A1D2DCE7604E478|YycA], according to UniProt)
  • Paralogous protein(s)

  • [protein|CFEA05E10517C00222126F959A1D2DCE7604E478|YycA]
  • Expression and Regulation

    Operons

    genes
    [gene|7039FCF49F97FFEF37ED48D6F860E3873A5CF308|ykcB]-[gene|FD76A781162795EAF174B59C0A90D2ED3ACC0AB7|ykcC]
    description
    [Pubmed|18175906]

    regulatory mechanism

  • [protein|706983E6942E883D3A9D45693E7B4015AEABE60B|YclJ]: activation, [Pubmed|20512483], in [regulon|706983E6942E883D3A9D45693E7B4015AEABE60B|YclJ regulon]
  • [protein|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|YrkP]: activation, [Pubmed|18175906], in [regulon|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|YrkP regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A738 (ykcB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/738 NBRP B. subtilis, Japan]
  • BKE12880 ([gene|7039FCF49F97FFEF37ED48D6F860E3873A5CF308|ykcB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTATTTTTCACTCCTTT, downstream forward: _UP4_GCTGATGAATAGGAGGCAAA
  • BKK12880 ([gene|7039FCF49F97FFEF37ED48D6F860E3873A5CF308|ykcB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTATTTTTCACTCCTTT, downstream forward: _UP4_GCTGATGAATAGGAGGCAAA
  • References

  • 20512483,18175906,28189581