SubtiBank SubtiBank
yolA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yolA

unknown
locus
BSU_21540
pI
9.75
mw
17.09 kDa
protein length
155 aa Sequence Blast
gene length
468 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    2,272,896 2,273,363

    The protein

    Structure

  • [PDB|2LR4]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|7040EC033DB7B1960813D2378AC70262CB7B87C9|yolA]-[gene|1F99778502096A7EA726EB767E1BA5F0D1F770AB|yolB]
    description
    [Pubmed|20817675]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yolA]' and '[protein|search|yokL]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • BKE21540 ([gene|7040EC033DB7B1960813D2378AC70262CB7B87C9|yolA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTAAATCCTCCTTG, downstream forward: _UP4_GATTTTGAAAGAGAGTGAAC
  • BKK21540 ([gene|7040EC033DB7B1960813D2378AC70262CB7B87C9|yolA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTAAATCCTCCTTG, downstream forward: _UP4_GATTTTGAAAGAGAGTGAAC
  • References

  • 18957862,20525796,20817675