SubtiBank SubtiBank
yckB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yckB

similar to amino acid [SW|ABC transporter] (binding protein)
locus
BSU_03380
pI
8.49
mw
31.57 kDa
protein length
287 aa Sequence Blast
gene length
864 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.4|Unknown ABC transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    367,995 368,858

    The protein

    Protein family

  • [SW|bacterial solute-binding protein 3 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|2056F8EEDF9D3027CFD808E8D0C5DF544DBDD3F3|TcyA]
  • Structure

  • [PDB|2IEE]
  • [SW|Localization]

  • associated to the membrane (via [protein|1872614A6F7DBF7231348AC3DAE4ED3295ACEB41|YckA]) [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|7050A2CC4BA2183C3CD22A246846CBCE43D73ABC|yckB]-[gene|1872614A6F7DBF7231348AC3DAE4ED3295ACEB41|yckA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C053 (yckB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2051 NBRP B. subtilis, Japan]
  • CS208 (''[gene|7050A2CC4BA2183C3CD22A246846CBCE43D73ABC|yckB]''::''aphA3'', available in [SW|Colin Harwood]'s and [SW|Jörg Stülke]'s labs) [Pubmed|27197833]
  • BKE03380 ([gene|7050A2CC4BA2183C3CD22A246846CBCE43D73ABC|yckB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTATAGTTCCCCCAATC, downstream forward: _UP4_GACGTTGATTTGTAATCGGA
  • BKK03380 ([gene|7050A2CC4BA2183C3CD22A246846CBCE43D73ABC|yckB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTATAGTTCCCCCAATC, downstream forward: _UP4_GACGTTGATTTGTAATCGGA
  • References

  • 10092453,23038252,27197833