SubtiBank SubtiBank
acoR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

acoR

transcriptional activator of the [gene|B0A333BDFAE816B48B856A1DD91B73C41584A8E4|acoA]-[gene|5F953C3C91EB65A031D04A1D91F1CF501F8EFD09|acoB]-[gene|C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34|acoC]-[gene|search|acoL ]operon
locus
BSU_08100
pI
7.88
mw
66.98 kDa
protein length
605 aa Sequence Blast
gene length
1818 bp Sequence Blast
function
regulation of acetoin utilization
product
transcriptional activator (for [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]-dependent promoter)
essential
no
synonyms
yfjG,yzcB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.2|Utilization of acetoin]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    883,758 885,575

    The protein

    Protein family

  • [SW|Transcription factors activating transcription at SigL-dependent promoters]
  • [SW|Domains]

  • Sigma-54 factor interaction domain (aa 295-520) (according to UniProt)
  • Structure

  • [PDB|5EXX] (from Pseudomonas aeruginosa, C-terminal doamin, corresponds to aa 292 ... 598, 43% identity) [pubmed|26712005]
  • Expression and Regulation

    Operons

    genes
    [gene|706864AAF36684AD5E46F30E9EB76315AB412700|acoR]-[gene|4A4A533542E47DE8114B697FADE4CB581E5FB66E|sspH]
    description
    [Pubmed|11274109]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22900538], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed by glucose (3.7-fold) ([protein|search|CcpA]) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C352 (acoR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2350 NBRP B. subtilis, Japan]
  • 1A912 ( ''acoR''::''kan''), [Pubmed|16585774], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A912&Search=1A912 BGSC] and in [SW|Jörg Stülke]'s lab
  • BKE08100 ([gene|706864AAF36684AD5E46F30E9EB76315AB412700|acoR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTTGATCGCTCCTC, downstream forward: _UP4_TAAAGCATACTTCCTTCAGG
  • BKK08100 ([gene|706864AAF36684AD5E46F30E9EB76315AB412700|acoR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTTGATCGCTCCTC, downstream forward: _UP4_TAAAGCATACTTCCTTCAGG
  • labs

  • [SW|Michel Debarbouille], Pasteur Institute, Paris, France [http://www.pasteur.fr/ip/easysite/go/03b-00000m-0ob/recherche/departements-scientifiques/microbiologie/unites-et-groupes/unite-de-biologie-des-bacteries-pathogenes-a-gram-positif/les-membres-de-l-equipe Homepage]
  • References

  • 11274109,10368162,22900538,12850135,21906631,26712005