SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


two-component response regulator ([SW|OmpR family]), active under anaerobic conditions
26.36 kDa
protein length
227 aa Sequence Blast
gene length
684 bp Sequence Blast
two-component response regulator ([SW|OmpR family])

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    426,577 427,260

    The protein

    Protein family

  • [SW|OmpR family] of two-component response regulators
  • Paralogous protein(s)

  • [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR], [protein|6A37531896205A9B894C81AB0563C216C0B52CD7|YkoG], [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]
  • [SW|Domains]

  • [SW|Response regulatory domain] (aa 2-115) (according to UniProt)
  • Modification

  • phosphorylated by [protein|52BB660B0CAB36C74F1D47963235846B45AF78AB|YclK] on an Asp residue
  • Effectors of protein activity

  • phosphorylation likely affects DNA-binding activity
  • Structure

  • [PDB|2OQR] (RegX3 from Mycobacterium tuberculosis, 42% identity) [pubmed|17942407]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|15375128], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|15375128]
  • view in new tab

    Biological materials


  • MGNA-C007 (yclJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE03750 ([gene|706983E6942E883D3A9D45693E7B4015AEABE60B|yclJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATATCCTCCGGTTGTT, downstream forward: _UP4_ACTGTGTGGGGAGTAGGGTA
  • BKK03750 ([gene|706983E6942E883D3A9D45693E7B4015AEABE60B|yclJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATATCCTCCGGTTGTT, downstream forward: _UP4_ACTGTGTGGGGAGTAGGGTA
  • References

  • 10094672,20512483,15375128,23504016,17942407