SubtiBank SubtiBank
yhcH
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yhcH

similar to [SW|ABC transporter] (ATP-binding protein)
locus
BSU_09080
pI
6.37
mw
34.32 kDa
protein length
305 aa Sequence Blast
gene length
918 bp Sequence Blast
function
unknown
product
[SW|ABC transporter] (ATP-binding protein)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.2|Exporters] → [category|SW 1.2.1.2.6|Exporters of unknown function]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    982,319 983,236

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|5364730C4DD7FFFB238DA190889CECF6C63F1050|YdbJ]
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 5-233) (according to UniProt)
  • Structure

  • [PDB|4YER] (from Thermotoga maritima, 29% identity)
  • [SW|Localization]

  • membrane associated (via [protein|BAD93C5EAD25F1A257907F4C631C02FE97C7BC89|YhcI]) [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|74B0D594308D313A54C7163759628655382B1F94|yhcE]-[gene|53E29A238EC817CE9B430BDED92DE8E9746C928B|yhcF]-[gene|E71E305A0DE5AB6BE24CE47DC1ECCD99670C24D8|yhcG]-[gene|70858AED096A80C1EAEB81F4B048368B665AB515|yhcH]-[gene|BAD93C5EAD25F1A257907F4C631C02FE97C7BC89|yhcI]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A653 (yhcH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/653 NBRP B. subtilis, Japan]
  • BKE09080 ([gene|70858AED096A80C1EAEB81F4B048368B665AB515|yhcH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATATTCCTCCTCTTTC, downstream forward: _UP4_AGCATGCTTAATTTGATTTA
  • BKK09080 ([gene|70858AED096A80C1EAEB81F4B048368B665AB515|yhcH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATATTCCTCCTCTTTC, downstream forward: _UP4_AGCATGCTTAATTTGATTTA
  • References

  • 10092453,21815947