SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


two-component response regulator (OmpR family)
27.00 kDa
protein length
237 aa Sequence Blast
gene length
711 bp Sequence Blast
regulation cell surface maintenance
two-component response regulator (OmpR family)

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    3,408,353 → 3,409,066

    Phenotypes of a mutant

  • unusual autolysis and higher susceptibility to cell envelope antibiotics (bacitracin, aztreonam, cefepime, fosfomycin) [Pubmed|16306698]
  • The protein

    Catalyzed reaction/ biological activity

  • transcription activator [Pubmed|16306698]
  • Protein family

  • [SW|OmpR family] of two-component response regulators
  • Modification

  • phosphorylation (Asp) by [protein|96E4470EF4B558F4EC318FEBF58B779BA50DB7E2|YvrG] [Pubmed|16306698]
  • Effectors of protein activity

  • phosphorylation likely affects DNA-binding activity
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Biological materials


  • MGNA-B050 (yvrH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33221 (Δ[gene|7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTTATGTTCCTTTCTG, downstream forward: _UP4_CCAAATCCTGAAGGCAAGCG
  • BKK33221 (Δ[gene|7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTTATGTTCCTTTCTG, downstream forward: _UP4_CCAAATCCTGAAGGCAAGCG
  • References

  • 10094672,18820022,16306698