SubtiBank SubtiBank
yvrHb

yvrHb

two-component response regulator ([SW|OmpR family])
locus
BSU_33221
pI
5.24
mw
27.00 kDa
protein length
237 aa Sequence Blast
gene length
714 bp Sequence Blast
function
regulation cell surface maintenance
product
two-component response regulator ([SW|OmpR family])
essential
no
synonyms
yvrH

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.1|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    Coordinates
    3,408,353 3,409,066

    Phenotypes of a mutant

  • unusual autolysis and higher susceptibility to cell envelope antibiotics (bacitracin, aztreonam, cefepime, fosfomycin) [Pubmed|16306698]
  • The protein

    Catalyzed reaction/ biological activity

  • transcription activator [Pubmed|16306698]
  • Protein family

  • [SW|OmpR family] of two-component response regulators
  • [SW|Domains]

  • [SW|Response regulatory domain] (aa 5-119) (according to UniProt)
  • Modification

  • phosphorylation (Asp) by [protein|96E4470EF4B558F4EC318FEBF58B779BA50DB7E2|YvrG] [Pubmed|16306698]
  • Effectors of protein activity

  • phosphorylation likely affects DNA-binding activity
  • Structure

  • [PDB|2OQR] (from Mycobacterium tuberculosis, 37% identity) [pubmed|17942407]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb]-[gene|96E4470EF4B558F4EC318FEBF58B779BA50DB7E2|yvrG]-[gene|0F65F634368E935585FC015BA64085F3A2244F9B|yvrE]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B050 (yvrH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1049 NBRP B. subtilis, Japan]
  • BKE33221 ([gene|7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33221 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTTATGTTCCTTTCTG, downstream forward: _UP4_CCAAATCCTGAAGGCAAGCG
  • BKK33221 ([gene|7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33221 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTTATGTTCCTTTCTG, downstream forward: _UP4_CCAAATCCTGAAGGCAAGCG
  • References

  • 10094672,18820022,16306698,17942407