SubtiBank SubtiBank
yteA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yteA

sporulation protein
locus
BSU_30840
pI
4.03
mw
27.56 kDa
protein length
239 aa Sequence Blast
gene length
720 bp Sequence Blast
function
unknown
product
sporulation protein
essential
no
synonyms
yzwB

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    3,154,007 3,154,726

    The protein

    Paralogous protein(s)

  • [protein|8AB50581EBB3C27BB9A96EA3382F8C90CE5B6EC5|YlyA], [protein|633F6F54AFA144D4F65EA36B8D5670D3FC25EDA6|YocK]
  • Expression and Regulation

    Operons

    genes
    [gene|70A5A147B908001878161D45AAEB08132AD0DB8C|yteA]
    description
    [Pubmed|9387221]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: activation, [Pubmed|23123912], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed late during [SW|sporulation] in the forespore ([protein|search|SigG], [SW|SpoVT]) [Pubmed|23123912,16497325]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A282 (yteA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/282 NBRP B. subtilis, Japan]
  • BKE30840 ([gene|70A5A147B908001878161D45AAEB08132AD0DB8C|yteA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTGATCGCCTCGTTTC, downstream forward: _UP4_CTCCACGCTGATTGAACCCC
  • BKK30840 ([gene|70A5A147B908001878161D45AAEB08132AD0DB8C|yteA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTGATCGCCTCGTTTC, downstream forward: _UP4_CTCCACGCTGATTGAACCCC
  • References

  • 16497325,9387221,23123912