SubtiBank SubtiBank
opuBB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

opuBB

choline and arsenocholine [SW|ABC transporter] (membrane protein)
locus
BSU_33720
pI
9.74
mw
23.02 kDa
protein length
217 aa Sequence Blast
gene length
654 bp Sequence Blast
function
compatible solute transport
product
choline and arsenocholine [SW|ABC transporter] (membrane protein)
essential
no
synonyms
proW

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.4|Uptake of compatible solutes for osmoprotection]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,461,435 3,462,088

    The protein

    Catalyzed reaction/ biological activity

  • uptake of choline and arsenocholine [pubmed|29159878]
  • Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • [SW|CysTW subfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|83C45215AC86FACB08CF36EB5F9E6B076D7D0F0F|OpuCB]
  • [SW|Domains]

  • [SW|ABC transmembrane type-1 domain] (aa 19-198) (according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|3F502A4DCB1DAD7C3F968465B13C35213240515B|opuBA]-[gene|70B45E7428DB1F6AEF7D2FE3062CC86BE96674FC|opuBB]-[gene|C48798FE13B1521236F5BC5786B9A02D7BC9A336|opuBC]-[gene|1532EC3D741C5AB3D0B642741218FAE00AD460FA|opuBD]
    description
    [Pubmed|10216873]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10216873], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|GbsR]: repression, (transcriptional roadblock) [Pubmed|32849357,22408163], in [regulon|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|GbsR regulon]
  • [protein|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|OpcR]: repression, (sterical interference with RNA polymerase access) [Pubmed|32849357,23960087], in [regulon|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|OpcR regulon]
  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • regulation

  • induced by choline ([protein|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|GbsR]) [Pubmed|22408163]
  • expression increases with increasing salinity [Pubmed|32849357]
  • additional information

  • [gene|6FCF6F71C5A8B2345F42BD0C3345C520FD40358B|S1290] acts as [SW|ncRNA|antisense RNA] for the [gene|3F502A4DCB1DAD7C3F968465B13C35213240515B|opuBA]-[gene|70B45E7428DB1F6AEF7D2FE3062CC86BE96674FC|opuBB]-[gene|C48798FE13B1521236F5BC5786B9A02D7BC9A336|opuBC]-[gene|1532EC3D741C5AB3D0B642741218FAE00AD460FA|opuBD] operon [PubMed|,32373088,20525796]
  • expression starts with a delay after osmotic upshift due to transcriptional interference of [SW|RNA polymerase] complexes driving synthesis of the converging opuB and [gene|6FCF6F71C5A8B2345F42BD0C3345C520FD40358B|S1290] mRNAs [pubmed|32373088]
  • view in new tab

    Biological materials

    Mutant

  • BKE33720 ([gene|70B45E7428DB1F6AEF7D2FE3062CC86BE96674FC|opuBB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACTTATCGCCCCTCCC, downstream forward: _UP4_GAATTGTCATAAGGAGGCGG
  • BKK33720 ([gene|70B45E7428DB1F6AEF7D2FE3062CC86BE96674FC|opuBB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACTTATCGCCCCTCCC, downstream forward: _UP4_GAATTGTCATAAGGAGGCGG
  • References

    Reviews

  • 27935846
  • Original publications

  • 10092453,9925583,10216873,23646920,21296969,23960087,22408163,29159878,32373088