SubtiBank SubtiBank
ywrA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ywrA

subunit of chromate exporter (with [protein|E63704C51B53F05BAD9B35D3B6874DB9231B6D24|YwrB])
locus
BSU_36130
pI
9.94
mw
19.08 kDa
protein length
178 aa Sequence Blast
gene length
537 bp Sequence Blast
function
chromate detoxification
product
chromate exporter
essential
no
synonyms
chr3C

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.11|Other exporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,722,005 3,722,541

    The protein

    Protein family

  • chromate ion transporter (CHR) (TC 2.A.51) family (with [protein|E63704C51B53F05BAD9B35D3B6874DB9231B6D24|YwrB], according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|22900751]
  • Expression and Regulation

    Operons

    genes
    [gene|C0BEEAD315077FE3D0D061D1D447D03E6CB48D6A|chrS]-[gene|E63704C51B53F05BAD9B35D3B6874DB9231B6D24|ywrB]-[gene|70CC5C9BCC676AB89C0BF80686BD98BA08FAE648|ywrA]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23989926], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|C0BEEAD315077FE3D0D061D1D447D03E6CB48D6A|ChrS]: repression, [Pubmed|23989926], in [regulon|C0BEEAD315077FE3D0D061D1D447D03E6CB48D6A|ChrS regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A569 (ywrA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/569 NBRP B. subtilis, Japan]
  • BKE36130 ([gene|70CC5C9BCC676AB89C0BF80686BD98BA08FAE648|ywrA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCCATAAATAAATAGATCG, downstream forward: _UP4_TAGAAAAAAGCACCTGGACA
  • BKK36130 ([gene|70CC5C9BCC676AB89C0BF80686BD98BA08FAE648|ywrA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCCATAAATAAATAGATCG, downstream forward: _UP4_TAGAAAAAAGCACCTGGACA
  • References

  • 19581367,22383849,22900751,23989926