SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to [SW|ABC transporter] (ATP-binding protein)
66.08 kDa
protein length
585 aa Sequence Blast
gene length
1758 bp Sequence Blast
[SW|ABC transporter] (ATP-binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Exporters] → [category|SW|Exporters of unknown function]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,499,889 1,501,646

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|C6B0ACB9D9703DD8141FD7D9D62DB22FB48F458B|YknV], [protein|D5A3C316BD4567A0155F70330E32ACDE18F063FE|YwjA], [protein|E85814EDF232D21A42380D559EAD2CDFB41F19DB|YfiC], [protein|ED1F82463BAA28B67184BFAB5CB23CF26A62999D|BmrA], [protein|0EB4D3E1B9AF39ECCBD79EB559FAE5BB0EE4C156|YgaD], [protein|288CA73D93B1E5106E1C6CE5E7E2E8BE2A6BD3F3|YfiB], [protein|67C0C9EA17EF953554D3D57CD0D285246F50C1AD|BmrC]
  • [SW|Domains]

  • has both a membrane-spanning and an ATP-binding domain [Pubmed|10092453]
  • [SW|ABC transmembrane type-1 domain] (aa 18-301) (according to UniProt)
  • [SW|ABC transporter domain] (aa 335-570) (according to UniProt)
  • Structure

  • [PDB|5MKK] (TmrAB complex from Thermus thermophilus, 37% identity) [pubmed|28069938]
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B346 (yknU::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE14320 ([gene|70D7098BEBD5E53B4B9B8C3394FAAF972C65EE22|yknU]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCCAGCACCTTTCCAA, downstream forward: _UP4_GAGGTCGGATAGGGAGGGGC
  • BKK14320 ([gene|70D7098BEBD5E53B4B9B8C3394FAAF972C65EE22|yknU]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCCAGCACCTTTCCAA, downstream forward: _UP4_GAGGTCGGATAGGGAGGGGC
  • References

  • 10092453,28069938