SubtiBank SubtiBank
ydaK
The papers of the month are back! Check them out! Link here

ydaK

general stress protein, may act as c-di-GMP receptor, required for extracellular polysaccharide synthesis by [protein|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|YdaL]-[protein|961538BEDD27C24FC073AFB7AB3268E3D46783CC|YdaM]-[protein|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|YdaN]
locus
BSU04280
pI
6.70
mw
32.53 kDa
protein length
283 aa Sequence Blast
gene length
849 bp Sequence Blast
function
unknown
product
general stress protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    Coordinates
    480,013 → 480,864

    The protein

    [SW|Domains]

  • four transmembrane helices at the N-terminus, they are essential fro activation of EPS formation by [protein|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|YdaL], [protein|961538BEDD27C24FC073AFB7AB3268E3D46783CC|YdaM], and [protein|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|YdaN] [pubmed|28536559]
  • contains a C-terminal degenerated [SW|GGDEF domain] [Pubmed|23893111]
  • [SW|Cofactors]

  • binds c-di-GPM at high concentration (K(D) for c-di-GMP: 1.1 myM) [Pubmed|23893111]
  • [SW|Localization]

  • cell membrane, forms clusters at the cell poles and septa (with [protein|961538BEDD27C24FC073AFB7AB3268E3D46783CC|YdaM] and [protein|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|YdaN]) [Pubmed|27897378]
  • Expression and Regulation

    Operons

    genes
    [gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]-[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]-[gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|22383849], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • expressed during stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|22383849]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C074 (ydaK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2072 NBRP B. subtilis, Japan]
  • GP1592 (kan) available in [SW|Jörg Stülke]'s lab
  • JH642 and its derivatives: natural deletion of the 18 kb [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH] region encompassing the genes [gene|467E9CF20B545A976614968E7DD5497F9390D344|ydzA]-[gene|7D5327BD1DD5FD5F90B2C849589923AA3D8B20EF|topB]-[gene|69DEE29383E40F49890CC8314DFBF56D70D35113|ydaJ]-[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]-[gene|28D80C5497AE29A24AD6B9A1A713A2B3915F2CED|ydaL]-[gene|961538BEDD27C24FC073AFB7AB3268E3D46783CC|ydaM]-[gene|ADE0122D8FFF2F78B6D21031B7D02A323A13ED63|ydaN]-[gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]-[gene|6085BDAD40F719555EA4EEA7BBAD74103BD03D0F|mutT]-[gene|2883FC60CD69948D5C43BDDFEFBE7A1CA7C743C7|ydaP]-[gene|87834D5C47064BEFF26F086A8202C311F28F9D38|ydzK]-[gene|search|mntH ][pubmed|18670626]
  • BKE04280 (Δ[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAAATAAGCAAATAATTTTT, downstream forward: _UP4_ATGAATGAACTATAAAGGAA
  • BKK04280 (Δ[gene|70ED3CE683F3A3F785480F40986CABE7729C17C7|ydaK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAAATAAGCAAATAATTTTT, downstream forward: _UP4_ATGAATGAACTATAAAGGAA
  • References

    Reviews

  • 28296273
  • Original publications

  • 22383849,22821967,23893111,27897378,28536559