SubtiBank SubtiBank
yonR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yonR

similar to transcription regulator ([SW|Xre family])
locus
BSU_21020
pI
5.60
mw
12.23 kDa
protein length
108 aa Sequence Blast
gene length
327 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,221,061 2,221,387

    The protein

    Protein family

  • [SW|Xre family]
  • Paralogous protein(s)

  • [protein|846161AE54F170075F2B2133A8D56FE39A5AF8D9|SknR]
  • [SW|Domains]

  • [SW|HTH cro/C1-type domain] (aa 6-60) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|71012848B12CB7BCDEEACDAC6AD1966A971F8FAB|yonR]-[gene|8FAC496D7A28DA74A7F866AF24C842F733EE20BE|yonS]
    description
    [Pubmed|29794222]

    regulation

  • the mRNA is processed between [gene|71012848B12CB7BCDEEACDAC6AD1966A971F8FAB|yonR] and [gene|8FAC496D7A28DA74A7F866AF24C842F733EE20BE|yonS] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • BKE21020 ([gene|71012848B12CB7BCDEEACDAC6AD1966A971F8FAB|yonR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTAGGTTCCTCACTTT, downstream forward: _UP4_TAGTAGCTATTCTTAATTCT
  • BKK21020 ([gene|71012848B12CB7BCDEEACDAC6AD1966A971F8FAB|yonR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTAGGTTCCTCACTTT, downstream forward: _UP4_TAGTAGCTATTCTTAATTCT
  • References

  • 23504016,29794222