SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


similar to transcriptional regulator ([SW|TetR family])
21.74 kDa
protein length
194 aa Sequence Blast
gene length
585 bp Sequence Blast
putative transcriptional regulator ([SW|TetR family])

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factor/ other/ based on similarity]
  • Gene

    753,817 754,401

    The protein

    Protein family

  • [SW|TetR family]
  • Structure

  • [PDB|2I10] (from Rhodococcus sp., 30% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE06860 ([gene|71344F56CC91C0A62D30C736AF132AA3DAFFCCF2|yezE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAAATGATCACCTCCTG, downstream forward: _UP4_TAACATGTGGTAAAGGATTC
  • BKK06860 ([gene|71344F56CC91C0A62D30C736AF132AA3DAFFCCF2|yezE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAAATGATCACCTCCTG, downstream forward: _UP4_TAACATGTGGTAAAGGATTC
  • References


  • 24006471