SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


regulator of carbon partitioning between central metabolism and peptidoglycan biosynthesis, control of [SW|cell shape], required for correct localization of [protein|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|PBP1]
34.53 kDa
protein length
317 aa Sequence Blast
gene length
954 bp Sequence Blast
regulation of carbon partitioning between central metabolism and peptidoglycan biosynthesis, localization of [protein|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|PBP1]
activator of [protein|4E23D2043D51C587027ABBF6335F148295E90B8F|GlmS] activity

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Biosynthesis of peptidoglycan]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.2|Cell shape]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW|Biosynthesis of peptidoglycan]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    3,570,546 3,571,499

    Phenotypes of a mutant

  • unable to grow with gluconeogenic substrates as single carbon source, this can be suppressed by mutations in [gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR], [gene|43CD2581DA421CABC66E30389640CC86E6B2D800|zwf], [gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH], [gene|418900B6DBDF3EF300C930B0C75E31B939F3CE00|ltaS], [gene|CCD06F344E3C87E77C3D13883CE2B927F372A84E|yfnI], upon overexpression of [gene|4E23D2043D51C587027ABBF6335F148295E90B8F|glmS] or by a point mutation in [protein|70412A747D1ED3E885126945DF02503667C13E5B|PgcA] (G47S) that results in increased phosphoglucosamine mutase activity [Pubmed|31589605,30478337,30248093,16272399]
  • filamentous or L-shape-like aberrant morphologies (suppressed by Mg2+) [Pubmed|16272399], this is supressed by overexpression of [protein|A4C8719E06F774A6EB4D79757CC79CF89E453A54|MreB] or by deletion of [gene|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|PBP1], [gene|418900B6DBDF3EF300C930B0C75E31B939F3CE00|ltaS], or [gene|CCD06F344E3C87E77C3D13883CE2B927F372A84E|yfnI] [Pubmed|30478337,21320184]
  • a [gene|70412A747D1ED3E885126945DF02503667C13E5B|pgcA] [gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR] double mutant is not viable, this can be suppressed by overexpression of [protein|F022ACB2CBB8DA46B392CE1D26474093645F26DA|GlmM] [pubmed|31589605]
  • The protein

    Catalyzed reaction/ biological activity

  • stimulates [protein|4E23D2043D51C587027ABBF6335F148295E90B8F|GlmS] activity to facilitate the diversion of carbon from fructose-6-phosphate to peptidoglycan synthesis [pubmed|30248093]
  • Protein family

  • gluconeogenesis factor family (single member, according to UniProt)
  • [SW|Domains]

  • phosphorylated on Thr-304 by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC], dephosphorylated by [protein|84447F9A6644EA8A7593BB99B2B69D4377E670E2|PrpC] [Pubmed|25012659]
  • Effectors of protein activity

  • binds UDP-GlcNAc [pubmed|28646159], this prevents the stimulation of [protein|4E23D2043D51C587027ABBF6335F148295E90B8F|GlmS] activity [pubmed|30248093]
  • Structure

  • [PDB|2O2Z] (the protein from ''B. halodurans'', 63% identity, 86% similarity)
  • [SW|Localization]

  • localized as a helical-like pattern [Pubmed|25012659,21320184]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16272399], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • constitutive expression at both protein and RNA levels [Pubmed|24097947,22383849]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yvcI]' and '[protein|search|trxB]' [PubMed|20525796]
  • view in new tab

    additional information

  • translation is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials


  • MGNA-B640 (yvcK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34760 (Δ[gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCGATTTTCGGCTTTTGTC, downstream forward: _UP4_TGAAGCCTTGAAATGAGGTG
  • BKK34760 (Δ[gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCGATTTTCGGCTTTTGTC, downstream forward: _UP4_TGAAGCCTTGAAATGAGGTG
  • Expression vectors

  • pGP736 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Boris Görke]'s lab
  • labs

  • [SW|Anne Galinier], University of Marseille, France
  • References


  • 21371139
  • Original publications

  • 9237995,16272399,21320184,25012659,25047842,27806131,28646159,30248093,30478337,31589605