SubtiBank SubtiBank
glmR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

glmR

regulator of carbon partitioning between central metabolism and peptidoglycan biosynthesis, control of [SW|cell shape], required for correct localization of [protein|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|PBP1]
locus
BSU_34760
pI
5.41
mw
34.53 kDa
protein length
317 aa Sequence Blast
gene length
954 bp Sequence Blast
function
regulation of carbon partitioning between central metabolism and peptidoglycan biosynthesis, localization of [protein|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|PBP1]
product
activator of [protein|4E23D2043D51C587027ABBF6335F148295E90B8F|GlmS] activity
essential
no
synonyms
yvcK

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.1|Biosynthesis of peptidoglycan]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.2|Cell shape]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.1|Biosynthesis of peptidoglycan]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    Coordinates
    3,570,546 3,571,499

    Phenotypes of a mutant

  • unable to grow with gluconeogenic substrates as single carbon source, this can be suppressed by mutations in [gene|ADA6F2EDC7B18FDFFA47CC8C55BCDDE1B6821160|cggR], [gene|43CD2581DA421CABC66E30389640CC86E6B2D800|zwf], [gene|8D0885839CD60C05FB806BBF08AFA05225E83B12|pgpH], [gene|418900B6DBDF3EF300C930B0C75E31B939F3CE00|ltaS], [gene|CCD06F344E3C87E77C3D13883CE2B927F372A84E|yfnI], or upon overexpression of [gene|4E23D2043D51C587027ABBF6335F148295E90B8F|glmS] [Pubmed|30478337,30248093,16272399]
  • filamentous or L-shape-like aberrant morphologies (suppressed by Mg2+) [Pubmed|16272399], this is supressed by overexpression of [protein|A4C8719E06F774A6EB4D79757CC79CF89E453A54|MreB] or by deletion of [gene|A8EEC896B279CFDDE9C3A6F146A04EC822E33A4F|PBP1], [gene|418900B6DBDF3EF300C930B0C75E31B939F3CE00|ltaS], or [gene|CCD06F344E3C87E77C3D13883CE2B927F372A84E|yfnI] [Pubmed|30478337,21320184]
  • The protein

    Catalyzed reaction/ biological activity

  • stimulates [protein|4E23D2043D51C587027ABBF6335F148295E90B8F|GlmS] activity to facilitate the diversion of carbon from fructose-6-phosphate to peptidoglycan synthesis [pubmed|30248093]
  • Protein family

  • gluconeogenesis factor family (single member, according to UniProt)
  • [SW|Domains]

  • phosphorylated on Thr-304 by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC], dephosphorylated by [protein|84447F9A6644EA8A7593BB99B2B69D4377E670E2|PrpC] [Pubmed|25012659]
  • Effectors of protein activity

  • binds UDP-GlcNAc [pubmed|28646159], this prevents the stimulation of [protein|4E23D2043D51C587027ABBF6335F148295E90B8F|GlmS] activity [pubmed|30248093]
  • Structure

  • [PDB|2O2Z] (the protein from ''B. halodurans'', 63% identity, 86% similarity)
  • [SW|Localization]

  • localized as a helical-like pattern [Pubmed|25012659,21320184]
  • Expression and Regulation

    Operons

    genes
    [gene|0C40455EB53D25363FC3EB0E84502A76520F5F91|yvcI]-[gene|EB12C6B4F36B57BF0C59CE048CBAE18734C78D35|yvcJ]-[gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR]-[gene|1986DB3078FBA16D6ACCD70EEAC95C46564D0958|whiA]-[gene|A269774F2FDC94F93BA5F1360FFFE754B50383AD|crh]-[gene|C521BEE1EEEA7AD283A3C47C34301A8603CD9188|yvcN]
    description
    [Pubmed|9237995]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16272399], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • constitutive expression at both protein and RNA levels [Pubmed|24097947,22383849]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yvcI]' and '[protein|search|trxB]' [PubMed|20525796]
  • view in new tab

    additional information

  • translation is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials

    Mutant

  • MGNA-B640 (yvcK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1639 NBRP B. subtilis, Japan]
  • BKE34760 (Δ[gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCGATTTTCGGCTTTTGTC, downstream forward: _UP4_TGAAGCCTTGAAATGAGGTG
  • BKK34760 (Δ[gene|7150BABA5086D5E2EB8102E4901A216F43576282|glmR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCGATTTTCGGCTTTTGTC, downstream forward: _UP4_TGAAGCCTTGAAATGAGGTG
  • Expression vectors

  • pGP736 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Boris Görke]'s lab
  • labs

  • [SW|Anne Galinier], University of Marseille, France
  • References

    Reviews

  • 21371139
  • Original publications

  • 9237995,16272399,21320184,25012659,25047842,27806131,28646159,30248093,30478337