SubtiBank SubtiBank
fnr
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

fnr

transcriptional regulator of anaerobic genes
locus
BSU_37310
pI
5.99
mw
27.07 kDa
protein length
238 aa Sequence Blast
gene length
717 bp Sequence Blast
function
regulation of anaerobiosis, fermentation and overflow metabolism
product
transcription regulator (Crp family)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.1|Regulators of electron transport]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    3,831,512 3,832,228

    The protein

    [SW|Cofactors]

  • [4Fe-4S] cluster [pubmed|29292548]
  • Effectors of protein activity

  • contains an iron-sulfur cluster
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000005 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|7165CC59CDAF64AAE2D591936860304A53BE5DF6|fnr]
    description
    [Pubmed|8846791]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8846791], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|10972836], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|EC6697D5D945B7E5083AFED9218748763C443278|NsrR]: repression, [Pubmed|16885456], in [regulon|EC6697D5D945B7E5083AFED9218748763C443278|NsrR regulon]
  • [protein|7165CC59CDAF64AAE2D591936860304A53BE5DF6|Fnr]: activation, [Pubmed|8846791,16428414], in [regulon|7165CC59CDAF64AAE2D591936860304A53BE5DF6|Fnr regulon]
  • regulation

  • ''[protein|search|fnr]'': expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
  • view in new tab

    genes
    [gene|F14481DAA196868ACC1DE9EC8CBE593A2CBB6BE4|narK]-[gene|7165CC59CDAF64AAE2D591936860304A53BE5DF6|fnr]
    description
    [Pubmed|8846791]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8846791], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|EC6697D5D945B7E5083AFED9218748763C443278|NsrR]: repression, [Pubmed|16885456], in [regulon|EC6697D5D945B7E5083AFED9218748763C443278|NsrR regulon]
  • [protein|7165CC59CDAF64AAE2D591936860304A53BE5DF6|Fnr]: activation, [Pubmed|8846791,16428414], in [regulon|7165CC59CDAF64AAE2D591936860304A53BE5DF6|Fnr regulon]
  • regulation

  • ''[protein|search|fnr]'': expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|10972836]
  • view in new tab

    Biological materials

    Mutant

  • BKE37310 ([gene|7165CC59CDAF64AAE2D591936860304A53BE5DF6|fnr]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGCTCACCTCGAAGAA, downstream forward: _UP4_TGAAAAAAACAAGGACAGCG
  • BKK37310 ([gene|7165CC59CDAF64AAE2D591936860304A53BE5DF6|fnr]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGCTCACCTCGAAGAA, downstream forward: _UP4_TGAAAAAAACAAGGACAGCG
  • References

    Reviews

  • 23046954,30225854
  • The [SW|Fnr regulon]

  • 16428414
  • Other original publications

  • 8682783,10972836,16885456,8846791,21068385,30225854