SubtiBank SubtiBank
folD
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

folD

methylenetetrahydrofolate dehydrogenase (NADP)
locus
BSU_24310
pI
5.60
mw
30.53 kDa
protein length
283 aa Sequence Blast
gene length
852 bp Sequence Blast
function
formylation of Met-tRNA(fMet)
product
methylenetetrahydrofolate dehydrogenase (NADP)
essential
no
ec
1.5.1.5
synonyms
yqiA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • Gene

    Coordinates
    2,528,404 2,529,255

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • inactivation of ''[gene|71FC6E75694B7066D808BAD736140569875E5E5C|folD]'' suppresses the synthetic lethality of the ''[gene|3D41FB608DB70B9482312A1BBCCDBDA7FB713AFA|defA] [gene|53B760316B19E142FC3ECAD2CFAA540377B08BBC|defB]'' double mutant [Pubmed|27983482]
  • The protein

    Catalyzed reaction/ biological activity

  • (6R)-5,10-methylene-5,6,7,8-tetrahydrofolate + NADP+ --> 5,10-methenyltetrahydrofolate + NADPH (according to UniProt)
  • 5,10-methenyltetrahydrofolate + H2O --> (6S)-10-formyltetrahydrofolate + H+ (according to UniProt)
  • Protein family

  • tetrahydrofolate dehydrogenase/cyclohydrolase family (single member, according to UniProt)
  • Structure

  • [PDB|1B0A] (from ''E. coli'', 52% identity) [Pubmed|10386884]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|6155468AFF216D97373CEF7B8C6E6C7BB9D4617F|nusB]-[gene|71FC6E75694B7066D808BAD736140569875E5E5C|folD]
    description
    [Pubmed|2536750,11591660]

    regulatory mechanism

  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|2536750,11591660], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • repressed in the presence of purine nucleotides ([protein|search|PurR]) [Pubmed|2536750,11591660]
  • view in new tab

    Biological materials

    Mutant

  • BKE24310 ([gene|71FC6E75694B7066D808BAD736140569875E5E5C|folD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTTTCCTCCTATGA, downstream forward: _UP4_TAGATAATTGGAGATATTCA
  • BKK24310 ([gene|71FC6E75694B7066D808BAD736140569875E5E5C|folD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTTTCCTCCTATGA, downstream forward: _UP4_TAGATAATTGGAGATATTCA
  • References

  • 11591660,19171795,11591660,19171795,10386884,27983482,28189581