SubtiBank SubtiBank
gntK
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

gntK

gluconokinase
locus
BSU_40060
pI
5.52
mw
57.00 kDa
protein length
513 aa Sequence Blast
gene length
1542 bp Sequence Blast
function
gluconate utilization
product
gluconokinase
essential
no
ec
2.7.1.12
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.13|Utilization of gluconate]
  • Gene

    Coordinates
    4,114,141 4,115,682

    The protein

    Catalyzed reaction/ biological activity

  • ATP + D-gluconate --> 6-phospho-D-gluconate + ADP + H+ (according to UniProt)
  • Protein family

  • [SW|FGGY kinase family] (according to UniProt)
  • Structure

  • [PDB|3GBT] (from ''Lactobacillus acidophilus'', 39% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|gntR]-[gene|72404FA6ECD62AEA3EFDB934DFB8DA581875605C|gntK]-[gene|C6810A4ACD51EB8D14E5B30163348058196266A1|gntP]-[gene|7E7187AA2DC172018A63A7B9CE48124F30311639|gntZ]
    description
    [pubmed|10746760,3020045]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3020045], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|GntR]: repression, [Pubmed|3020045], in [regulon|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|GntR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by gluconate ([protein|search|GntR]) [Pubmed|3020045]
  • view in new tab

    Biological materials

    Mutant

  • BKE40060 ([gene|72404FA6ECD62AEA3EFDB934DFB8DA581875605C|gntK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCCGATATCGATTCCTAACA, downstream forward: _UP4_TAGTACATGACATGAAGGGG
  • BKK40060 ([gene|72404FA6ECD62AEA3EFDB934DFB8DA581875605C|gntK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCCGATATCGATTCCTAACA, downstream forward: _UP4_TAGTACATGACATGAAGGGG
  • References

  • 3011959,8288545,3037520,2537826,6322857,3020045,10746760,8370661,3020045,1659648,220817675