SubtiBank SubtiBank
ykrK
The papers of the month are back! Check them out! Link here

ykrK

transcription repressor of [gene|search|htpX ]expression
locus
BSU13480
pI
6.15
mw
26.72 kDa
protein length
233 aa Sequence Blast
gene length
699 bp Sequence Blast
function
regulation of membrane protein quality control
product
transcription repressor of [gene|62B6875301B458F04E3F65717AD3A5925A9C4973|htpX]
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    1,414,125 → 1,414,826

    Expression and Regulation

    Operons

    genes
    [gene|7283CDE72293A68D0B35E0C028D22FABE7FB43C7|ykrK]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|7283CDE72293A68D0B35E0C028D22FABE7FB43C7|YkrK]: autoregulation, in [regulon|7283CDE72293A68D0B35E0C028D22FABE7FB43C7|YkrK regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A782 (ykrK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/782 NBRP B. subtilis, Japan]
  • BKE13480 (Δ[gene|7283CDE72293A68D0B35E0C028D22FABE7FB43C7|ykrK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTCACCTCTTTAAAC, downstream forward: _UP4_TAGTCTGCGCCACCCCGGCT
  • BKK13480 (Δ[gene|7283CDE72293A68D0B35E0C028D22FABE7FB43C7|ykrK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTCACCTCTTTAAAC, downstream forward: _UP4_TAGTCTGCGCCACCCCGGCT
  • References

  • 22447908,23042994