SubtiBank SubtiBank
ykrK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ykrK

transcription repressor of [gene|search|htpX ]expression
locus
BSU_13480
pI
6.15
mw
26.72 kDa
protein length
233 aa Sequence Blast
gene length
702 bp Sequence Blast
function
regulation of membrane protein quality control
product
transcription repressor of [gene|62B6875301B458F04E3F65717AD3A5925A9C4973|htpX]
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    1,414,125 1,414,826

    Expression and Regulation

    Operons

    genes
    [gene|7283CDE72293A68D0B35E0C028D22FABE7FB43C7|ykrK]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|7283CDE72293A68D0B35E0C028D22FABE7FB43C7|YkrK]: autoregulation, in [regulon|7283CDE72293A68D0B35E0C028D22FABE7FB43C7|YkrK regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A782 (ykrK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/782 NBRP B. subtilis, Japan]
  • BKE13480 ([gene|7283CDE72293A68D0B35E0C028D22FABE7FB43C7|ykrK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTCACCTCTTTAAAC, downstream forward: _UP4_TAGTCTGCGCCACCCCGGCT
  • BKK13480 ([gene|7283CDE72293A68D0B35E0C028D22FABE7FB43C7|ykrK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTCACCTCTTTAAAC, downstream forward: _UP4_TAGTCTGCGCCACCCCGGCT
  • References

  • 22447908,23042994