SubtiBank SubtiBank


cytochrome-c oxidase (subunit II)
39.94 kDa
protein length
356 aa Sequence Blast
gene length
1071 bp Sequence Blast
cytochrome-c oxidase (subunit II)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW|Terminal oxidases]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,560,466 1,561,536

    The protein

    Catalyzed reaction/ biological activity

  • 4 [Fe(II)cytochrome c] + 4 H+ + O2 --> 4 [Fe(III)cytochrome c] + 2 H2O (according to UniProt)
  • Protein family

  • cytochrome c oxidase subunit 2 family (with [protein|48A9E1E39838BFFCF12CADF0A8D8E6FFDCA6F175|QoxA], according to UniProt)
  • [SW|Domains]

  • Cytochrome c domain (aa 258-356) (according to UniProt)
  • [SW|Cofactors]

  • Cu(A) [Pubmed|10837475]
  • Structure

  • [PDB|2YEV] (from Thermus thermophilus, 35% identity) [pubmed|22763450]
  • [SW|Localization]

  • cell membrane [Pubmed|23880299]
  • Expression and Regulation



    regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|9829923], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh]: repression, synergistic repression with [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB], in [regulon|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, synergistic repression with [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]) [Pubmed|9829923]
  • view in new tab

    Biological materials


  • BKE14890 ([gene|72D5442C0EF3B404F7B615366E357B68C863CEB6|ctaC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCACCCAACCCCTTTT, downstream forward: _UP4_TAGGGAAGAAAGGGAGATAT
  • BKK14890 ([gene|72D5442C0EF3B404F7B615366E357B68C863CEB6|ctaC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCACCCAACCCCTTTT, downstream forward: _UP4_TAGGGAAGAAAGGGAGATAT
  • References

  • 9882689,1685007,10551842,9829923,12850135,23599347,20817675,23880299,10837475,27503613,22763450