SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


laccase, bilirubin oxidase, spore coat protein (outer)
58.33 kDa
protein length
513 aa Sequence Blast
gene length
1542 bp Sequence Blast
resistance of the spore
laccase, bilirubin oxidase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat proteins] → [category|SW|Class V]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • Gene

    683,462 685,003

    The protein

    Protein family

  • S.antibioticus phenoxazinone synthase (PhsA)
  • Structure

  • [PDB|2BHF] (reduced form)
  • [SW|Localization]

  • outer spore coat, more abundant at the mother cell-distal pole of the forespore, localization depends on [protein|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|CotE] [Pubmed|22171814,19933362]
  • Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,3135411], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|15383836]
  • additional information

  • [protein|search|translation] is likely to require [protein|search|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • view in new tab

    Biological materials


  • 1S101 ( ''cotA''::''cat''), [Pubmed|2821284], available at [ BGSC]
  • 1S134 ( ''cotA''::''kan''), [Pubmed|11514528], available at [ BGSC]
  • BKE06300 ([gene|73473E6556D374C8623A426E075038AD01AB7025|cotA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCATCTGTCCTTATC, downstream forward: _UP4_TAACCCGACAAACTTGCCTC
  • BKK06300 ([gene|73473E6556D374C8623A426E075038AD01AB7025|cotA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCATCTGTCCTTATC, downstream forward: _UP4_TAACCCGACAAACTTGCCTC
  • References


  • 23202530
  • Original publications

  • 15699190,3135411,11514528,1518043,2821284,19933362,20200715,20551082,20822511,21369750,22281748,23859715,22171814,22410485,15383836,26062535,24293734,24733162,25259857,25847445,26784443,27050268,28870294,29301022