SubtiBank SubtiBank
yodB
The papers of the month are back! Check them out! Link here

yodB

[SW|MarR/DUF24 family ]transcription repressor of [gene|CFFFFE96FB7AEEF7190F81332369F0A6834C34A4|azoR1], [gene|B7A0D1B3CAA2733A33BCCDDB6774ABF1A0223473|catD]-[gene|search|catE ]and [gene|search|yodC ]expression
locus
BSU19540
pI
4.74
mw
12.71 kDa
protein length
112 aa Sequence Blast
gene length
336 bp Sequence Blast
function
regulation of quinone and diamide detoxification
product
[SW|MarR/DUF24 family ]transcription repressor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    2,127,345 → 2,127,683

    Phenotypes of a mutant

  • increased resistance to catechol, quinones and diamide [Pubmed|20639328]
  • The protein

    Protein family

  • [SW|MarR/DUF24 family]
  • Paralogous protein(s)

  • [protein|E757C4B329A99E3D0C70C77437DF4DDA300CA5E7|YdzF], [protein|5B9C4932B2E76D6B8F6BDB640D1ADEE28F488FAD|CatR]
  • Modification

  • redox-controlled by intersubunit disulfide formation of Cys6 and Cys101' in response to quinones and diamide
  • Effectors of protein activity

  • responds distinctly to diamide or methyl-p-benzoquinone [Pubmed|27531959]
  • Structure

  • [PDB|5HS7] (reduced form) [Pubmed|27531959]
  • [PDB|5HS8] (diamide-treated form) [Pubmed|27531959]
  • [PDB|5HS9] (quinone-bound form) [Pubmed|27531959]
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000216 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|yodB]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB]: repression, in [regulon|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B433 (yodB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1432 NBRP B. subtilis, Japan]
  • BKE19540 (Δ[gene|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|yodB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGTCTTCATCCCTTCA, downstream forward: _UP4_TAAGGAAAGCGGCACCTGAA
  • BKK19540 (Δ[gene|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|yodB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGTCTTCATCCCTTCA, downstream forward: _UP4_TAAGGAAAGCGGCACCTGAA
  • Labs working on this gene/protein

  • [SW|Haike Antelmann],University of Greifswald, Germany
  • References

    Reviews

  • 18282125,20626317
  • Original Publications

  • 17158660,17407181,18208493,20639328,20652907,21749987,27531959