SubtiBank SubtiBank
yhfR
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yhfR

phosphatase involved in isopentenol (isoprenoid) biosynthesis
locus
BSU_10340
pI
5.16
mw
21.85 kDa
protein length
193 aa Sequence Blast
gene length
582 bp Sequence Blast
function
isoprenoid biosynthesis
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW 2.4.2.3|Biosynthesis of isoprenoids]
  • Gene

    Coordinates
    1,108,736 1,109,317

    Phenotypes of a mutant

  • no detectable phenotype [Pubmed|10869096]
  • The protein

    Catalyzed reaction/ biological activity

  • phosphatase involved in isopentenol (isoprenoid) biosynthesis
  • Protein family

  • similar to 2,3-diphosphoglycerate-dependent phosphoglycerate mutases [Pubmed|10869096]
  • Structure

  • [PDB|1H2F] (enzyme of ''B. stearothermophilus'') [Pubmed|11827481]
  • Additional information

  • The gene is annotated in KEGG as an ortholog of phosphoglycerate mutase (PGM) EC 5.4.2.1. In MetaCyc the protein is marked as similar to phosphoglycerate mutase. No EC annotation is available in Swiss-Prot. Pearson et al. ([Pubmed|10869096]) demonstrated that yhfR is non-essential for growth, sporulation, and spore germination. They also purified the gene, expressed it in ''B. subtilis'' but were not able to detect PGM activity in ''B. subtilis''. [Pubmed|19935659]
  • Expression and Regulation

    Operons

    genes
    [gene|73CB11C654E7A92D6F59B00E0710D3AA1FD2F099|yhfR]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA]: repression, in [regulon|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA regulon]
  • additional information

  • weakly expressed [http://www.ncbi.nlm.nih.gov/sites/entrez/10869096 PubMed]
  • view in new tab

    genes
    [gene|22215066A7BEA4E53189DE6639C19D1AD86DA7F4|yhfU]-[gene|5050649605DD782AF10FC0AEEA5F14036EC0197D|yhfT]-[gene|CF6B79564DBED3C6CAF64D01BD01D2A03675F16F|yhfS]-[gene|73CB11C654E7A92D6F59B00E0710D3AA1FD2F099|yhfR]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA]: repression, [Pubmed|11717296], in [regulon|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA regulon]
  • regulation

  • repressed in the presence of biotin ([protein|search|BirA]) [Pubmed|11717296]
  • additional information

  • weakly expressed [http://www.ncbi.nlm.nih.gov/sites/entrez/10869096 PubMed]
  • view in new tab

    genes
    [gene|5050649605DD782AF10FC0AEEA5F14036EC0197D|yhfT]-[gene|CF6B79564DBED3C6CAF64D01BD01D2A03675F16F|yhfS]-[gene|73CB11C654E7A92D6F59B00E0710D3AA1FD2F099|yhfR]
    description
    [Pubmed|22383849]

    additional information

  • weakly expressed [http://www.ncbi.nlm.nih.gov/sites/entrez/10869096 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A243 (yhfR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/243 NBRP B. subtilis, Japan]
  • BKE10340 ([gene|73CB11C654E7A92D6F59B00E0710D3AA1FD2F099|yhfR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAATCCCCTTCCTGAC, downstream forward: _UP4_TAAGAAAAAGACAGGCGTTT
  • BKK10340 ([gene|73CB11C654E7A92D6F59B00E0710D3AA1FD2F099|yhfR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAATCCCCTTCCTGAC, downstream forward: _UP4_TAAGAAAAAGACAGGCGTTT
  • References

  • 17693564,10869096,19935659,11827481,11514674