SubtiBank SubtiBank
yycQ
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yycQ

unknown
locus
BSU_40260
pI
10.68
mw
8.87 kDa
protein length
gene length
249 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    4,137,362 4,137,610

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|C9E47F807248375982D85839EC72921034F061FD|yycO]-[gene|271543C0F92164723DC26F8A6E1181B7C007692B|yycP]-[gene|73E176945BC0CFDB4A0412434CFD3868696B0A7F|yycQ]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|21636651], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|21636651]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B817 (yycQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1816 NBRP B. subtilis, Japan]
  • BKE40260 ([gene|73E176945BC0CFDB4A0412434CFD3868696B0A7F|yycQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGCTCCCATACTACCCTCCT, downstream forward: _UP4_TGATCTCTGTTTATGAAGAG
  • BKK40260 ([gene|73E176945BC0CFDB4A0412434CFD3868696B0A7F|yycQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGCTCCCATACTACCCTCCT, downstream forward: _UP4_TGATCTCTGTTTATGAAGAG
  • References

  • 22383849