SubtiBank SubtiBank
trmB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

trmB

tRNA (m7G46) methyltransferase
locus
BSU_29900
pI
6.35
mw
24.36 kDa
protein length
213 aa Sequence Blast
gene length
642 bp Sequence Blast
function
tRNA modification
product
tRNA (m7G46) methyltransferase
essential
no
ec
2.1.1.33
synonyms
ytmQ

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • Gene

    Coordinates
    3,059,547 3,060,188

    The protein

    Catalyzed reaction/ biological activity

  • guanosine46 in tRNA + S-adenosyl-L-methionine --> N7-methylguanosine46 in tRNA + S-adenosyl-L-homocysteine (according to UniProt)
  • Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • [SW|class I-like SAM-binding methyltransferase superfamily] (according to UniProt)
  • [SW|Cofactors]

  • S-adenosylmethionine [pubmed|16600901]
  • Structure

  • [PDB|2FCA] [pubmed|16600901]
  • Expression and Regulation

    Operons

    genes
    [gene|73ED086EED7CECBE2FCADFBC964F1263CF825DB0|trmB]
    description
    [Pubmed|9387221]
    view in new tab

    Biological materials

    Mutant

  • GP2649 ([gene|73ED086EED7CECBE2FCADFBC964F1263CF825DB0|trmB]::''cat''), available in [SW|Jörg Stülke]'s lab
  • MGNA-A435 (ytmQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/435 NBRP B. subtilis, Japan]
  • BKE29900 ([gene|73ED086EED7CECBE2FCADFBC964F1263CF825DB0|trmB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGATTGACACCTCTAT, downstream forward: _UP4_TAAAGACAGACTCTGACAGG
  • BKK29900 ([gene|73ED086EED7CECBE2FCADFBC964F1263CF825DB0|trmB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGATTGACACCTCTAT, downstream forward: _UP4_TAAAGACAGACTCTGACAGG
  • References

  • 16600901,9387221,27965289