SubtiBank SubtiBank
nifZ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

nifZ

cysteine desulfurase, biosynthesis of 4-thiouridine in tRNA
locus
BSU_29590
pI
6.34
mw
41.33 kDa
protein length
381 aa Sequence Blast
gene length
1146 bp Sequence Blast
function
biosynthesis of 4-thiouridine in tRNA
product
cysteine desulfurase
essential
no
synonyms
iscSB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • Gene

    Coordinates
    3,026,957 3,028,102

    The protein

    Catalyzed reaction/ biological activity

  • removes sulfuryl group from cysteine and transfers it to [protein|A64A59C2B15015F13911EC53763D370F780400FD|ThiI] [Pubmed|22773787]
  • [sulfur carrier]-H + L-cysteine --> [sulfur carrier]-SH + L-alanine (according to UniProt)
  • Protein family

  • [SW|Class-V pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|88ACE6B79534338F7C72F107B35A0B2384007088|SufS], [protein|A6746AE1B92A0CDCCB22B57B6DF78094BB0223A8|NifS], [protein|4F5945C3C8F18BD1B30D97CD516A06077C200B9D|YrvO], [protein|5424A936643C90B3DA2CB60FD0FD42A64F2BAF09|YcbU]
  • [SW|Cofactors]

  • PLP
  • Structure

  • [PDB|1EG5] (NifS-like protein from Thermotoga maritima, 35% identity, 55% similarity) [Pubmed|10715213]
  • Expression and Regulation

    Operons

    genes
    [gene|741DCFFBB8FF6A4E357EE5110EBE24412DE34244|nifZ]-[gene|A64A59C2B15015F13911EC53763D370F780400FD|thiI]-[gene|80B5DAED9B4BD015D877DB4819AB25FC5F165C6D|sspA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE29590 ([gene|741DCFFBB8FF6A4E357EE5110EBE24412DE34244|nifZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTTACTCCTTTAT, downstream forward: _UP4_TTAAGGGAAATGATGAGGTA
  • BKK29590 ([gene|741DCFFBB8FF6A4E357EE5110EBE24412DE34244|nifZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTTACTCCTTTAT, downstream forward: _UP4_TTAAGGGAAATGATGAGGTA
  • References

    Reviews

  • 19348578
  • Original publications

  • 10715213,22773787