SubtiBank SubtiBank
nifZ [2018-09-12 18:43:25]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

nifZ [2018-09-12 18:43:25]

cysteine desulfurase, biosynthesis of 4-thiouridine in tRNA
41.33 kDa
protein length
381 aa Sequence Blast
gene length
1143 bp Sequence Blast
biosynthesis of 4-thiouridine in tRNA
cysteine desulfurase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|tRNA modification and maturation]
  • Gene

    3,026,957 → 3,028,102

    The protein

    Catalyzed reaction/ biological activity

  • removes sulfuryl group from cysteine and transfers it to [protein|A64A59C2B15015F13911EC53763D370F780400FD|ThiI] [Pubmed|22773787]
  • Paralogous protein(s)

  • [protein|88ACE6B79534338F7C72F107B35A0B2384007088|SufS], [protein|A6746AE1B92A0CDCCB22B57B6DF78094BB0223A8|NifS], [protein|4F5945C3C8F18BD1B30D97CD516A06077C200B9D|YrvO], [protein|5424A936643C90B3DA2CB60FD0FD42A64F2BAF09|YcbU]
  • Structure

  • [PDB|1EG5] (NifS-like protein from Thermotoga maritima, 35% identity, 55% similarity) [Pubmed|10715213]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE29590 (Δ[gene|741DCFFBB8FF6A4E357EE5110EBE24412DE34244|nifZ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTTACTCCTTTAT, downstream forward: _UP4_TTAAGGGAAATGATGAGGTA
  • BKK29590 (Δ[gene|741DCFFBB8FF6A4E357EE5110EBE24412DE34244|nifZ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTTACTCCTTTAT, downstream forward: _UP4_TTAAGGGAAATGATGAGGTA
  • References


  • 19348578
  • Original publications

  • 10715213,22773787