SubtiBank SubtiBank
dctB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

dctB

C4-dicarboxylate binding protein, co-sensor for DctS
locus
BSU_04440
pI
4.89
mw
39.70 kDa
protein length
350 aa Sequence Blast
gene length
1053 bp Sequence Blast
function
sensing of C4-dicarboxylates
product
C4-dicarboxylate binding protein
essential
no
synonyms
ydbE

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • Gene

    Coordinates
    496,646 497,698

    The protein

    Catalyzed reaction/ biological activity

  • not involved in C4-dicarboxylate transport [Pubmed|24375102]
  • acts as co-sensor for [protein|9A96572B101358768EB20EE9438BE0E1424A4130|DctS] [Pubmed|24375102]
  • Protein family

  • bacterial solute-binding protein 7 family (single member, according to UniProt)
  • Structure

  • [PDB|4O94] (from Rhodopseudomonas palustris, 41% identity) [pubmed|25540822]
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|7428E80AC67A659B8602AF887EA7DFFD4976B40C|dctB]-[gene|01CE4BBBEB0C0855201D396FB8036F72B64EA7DD|ydbD]
    description
    [Pubmed|10708364]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • BKE04440 ([gene|7428E80AC67A659B8602AF887EA7DFFD4976B40C|dctB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAAAGCCCTCCCCTAT, downstream forward: _UP4_TAGTTCCCATCTCGATACGC
  • BKK04440 ([gene|7428E80AC67A659B8602AF887EA7DFFD4976B40C|dctB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAAAGCCCTCCCCTAT, downstream forward: _UP4_TAGTTCCCATCTCGATACGC
  • References

  • 10708364,24375102,25540822