SubtiBank SubtiBank
ybbA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ybbA

enterobactin esterase, release of iron from enterobactin
locus
BSU_01600
pI
7.91
mw
21.37 kDa
protein length
250 aa Sequence Blast
gene length
753 bp Sequence Blast
function
iron acquisition from enterobactin [pubmed|28283524]
product
enterobactin esterase [pubmed|28283524]
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.3|Acquisition of iron / Other]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.1|Acquisition of iron / Other]
  • Gene

    Coordinates
    179,595 180,347

    The protein

    Structure

  • [PDB|1GKL] (esterase from Clostridium thermocellum, 21% identity) [pubmed|11738044]
  • Expression and Regulation

    Operons

    genes
    [gene|516B13F337FD346B4A4A268E35D1EBABB05957E1|feuA]-[gene|57402D137E3D3791CAF0696421224F4E1DC1BA48|feuB]-[gene|F38F6D4841B3044EA0496B3A1C1D484018BDFEA4|feuC]-[gene|745167427618C4DA71848F9362043B66BC4E392E|ybbA]
    description
    [Pubmed|12354229]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|17725565], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • [protein|EB28A65CECE994DF2DF486DEACF40F2533703DB0|Btr]: activation, in the presence of the co-activators bacillibactin or enterobactin [Pubmed|17725565], in [regulon|EB28A65CECE994DF2DF486DEACF40F2533703DB0|Btr regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • induced by iron starvation (second wave to allow iron scavenging from the environment) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [pubmed|29133393]
  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • additional information

  • the presence of an iron-responsive element bound by [SW|CitB] between ''[SW|feuA]'' and ''[SW|feuB]'' suggests iron-dependent regulation by [SW|CitB] [Pubmed|10468622]
  • view in new tab

    Other regulations

  • [protein|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|CitB]: translation control,
  • Biological materials

    Mutant

  • BKE01600 ([gene|745167427618C4DA71848F9362043B66BC4E392E|ybbA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGTGTTCTGAAAGAGATC, downstream forward: _UP4_CGCTCAACCCTATGAGCGGT
  • BKK01600 ([gene|745167427618C4DA71848F9362043B66BC4E392E|ybbA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTGTGTTCTGAAAGAGATC, downstream forward: _UP4_CGCTCAACCCTATGAGCGGT
  • References

  • 17725565,12354229,10468622,27766092,28283524,29133393,11738044