SubtiBank SubtiBank
yvzC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvzC

similar to transcription regulator (Xre family)
locus
BSU_33650
pI
7.01
mw
8.97 kDa
protein length
gene length
234 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    3,456,282 3,456,515

    The protein

    Protein family

  • [SW|Xre family]
  • [SW|Domains]

  • [SW|HTH cro/C1-type domain] (aa 13-67) (according to UniProt)
  • Biological materials

    Mutant

  • BKE33650 ([gene|745215A0EE7CF294E724B5D53B512A962707EDF9|yvzC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTCCTCACCTTCCATT, downstream forward: _UP4_TAAAGTAACAAAAAACGCAA
  • BKK33650 ([gene|745215A0EE7CF294E724B5D53B512A962707EDF9|yvzC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTCCTCACCTTCCATT, downstream forward: _UP4_TAAAGTAACAAAAAACGCAA
  • References

  • 23504016