SubtiBank SubtiBank
ytxM
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ytxM

similar to prolyl aminopeptidase
locus
BSU_30810
pI
7.18
mw
30.55 kDa
protein length
274 aa Sequence Blast
gene length
825 bp Sequence Blast
function
ubiquinone and menaquinone biosynthesis
product
unknown
essential
no
ec
4.2.99.20
synonyms
ytfB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.9|Biosynthesis of menaquinone/ based on similarity]
  • Gene

    Coordinates
    3,149,751 3,150,575

    The protein

    Catalyzed reaction/ biological activity

  • 5-enolpyruvoyl-6-hydroxy-2-succinyl-cyclohex-3-ene-1-carboxylate --> (1R,6R)-6-hydroxy-2-succinyl-cyclohexa-2,4-diene-1-carboxylate + pyruvate (according to UniProt)
  • Protein family

  • [SW|AB hydrolase superfamily] (according to UniProt)
  • [SW|Domains]

  • [SW|AB hydrolase-1 domain] (aa 26-259) (according to UniProt)
  • Structure

  • [PDB|2XMZ] (from ''Staphylococcus aureus'', 34% identity) [Pubmed|21513522]
  • Expression and Regulation

    Operons

    genes
    [gene|8EFE4D2B07E54A0EE7D6821C9FEBFC7DC22FDE03|menF]-[gene|E3283812B7EB374EAC8722ECCE28432DE24B7B4C|menD]-[gene|74659B6794496912E139B3CF9EFF787B63729A3F|ytxM]-[gene|224584953B0BC1AF666CD69372B2D53AC56F6752|menB]-[gene|16412BAB04BBF9FD1C3653328923687874C81868|menE]-[gene|9B2F45BC37D4F356B366447A33DC95639EF484EE|menC]
    description
    [Pubmed|9387221,1629163,8550504]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8550504], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|mntA]' and '[protein|search|menC]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A283 (ytxM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/283 NBRP B. subtilis, Japan]
  • BKE30810 ([gene|74659B6794496912E139B3CF9EFF787B63729A3F|ytxM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACACCATCTGATACCGTTA, downstream forward: _UP4_TGACTCATTCACATAGAGAA
  • BKK30810 ([gene|74659B6794496912E139B3CF9EFF787B63729A3F|ytxM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACACCATCTGATACCGTTA, downstream forward: _UP4_TGACTCATTCACATAGAGAA
  • References

  • 10913081,9387221,1629163,8550504,12454479,21513522