SubtiBank SubtiBank
yybB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yybB

unknown
locus
BSU_40700
pI
5.51
mw
25.12 kDa
protein length
220 aa Sequence Blast
gene length
663 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,182,636 4,183,298

    The protein

    Protein family

  • [SW|metallo-beta-lactamase superfamily] (according to UniProt)
  • Structure

  • [PDB|2ZO4] (from Thermus thermophilus, 23% identity) [pubmed|18767153]
  • Biological materials

    Mutant

  • MGNA-B852 (yybB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1851 NBRP B. subtilis, Japan]
  • BKE40700 ([gene|7480F814D8109D7F7CF5D90A2A21BB724077B5B9|yybB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGCAAACCATCTCCTGTG, downstream forward: _UP4_TAATGGAAGTGAAAAACATA
  • BKK40700 ([gene|7480F814D8109D7F7CF5D90A2A21BB724077B5B9|yybB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGCAAACCATCTCCTGTG, downstream forward: _UP4_TAATGGAAGTGAAAAACATA
  • References

    Research papers

  • 18767153