SubtiBank SubtiBank
yybB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yybB

unknown
locus
BSU_40700
pI
5.51
mw
25.12 kDa
protein length
220 aa Sequence Blast
gene length
663 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,182,636 4,183,298

    The protein

    Protein family

  • [SW|metallo-beta-lactamase superfamily] (according to UniProt)
  • Structure

  • [PDB|2ZO4] (from Thermus thermophilus, 23% identity) [pubmed|18767153]
  • Biological materials

    Mutant

  • MGNA-B852 (yybB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1851 NBRP B. subtilis, Japan]
  • BKE40700 ([gene|7480F814D8109D7F7CF5D90A2A21BB724077B5B9|yybB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGCAAACCATCTCCTGTG, downstream forward: _UP4_TAATGGAAGTGAAAAACATA
  • BKK40700 ([gene|7480F814D8109D7F7CF5D90A2A21BB724077B5B9|yybB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGCAAACCATCTCCTGTG, downstream forward: _UP4_TAATGGAAGTGAAAAACATA
  • References

    Research papers

  • 18767153