SubtiBank SubtiBank
pckA
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

pckA

phosphoenolpyruvate carboxykinase
locus
BSU30560
pI
5.12
mw
58.13 kDa
protein length
527 aa Sequence Blast
gene length
1581 bp Sequence Blast
function
synthesis of phosphoenolpyruvate
product
phosphoenolpyruvate carboxykinase
essential
no
ec
4.1.1.49
synonyms
ppc

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.2|Gluconeogenesis]
  • Gene

    Coordinates
    3,129,530 → 3,131,113

    The protein

    Catalyzed reaction/ biological activity

  • ATP + oxaloacetate = ADP + phosphoenolpyruvate + CO2 (according to Swiss-Prot) ATP + oxaloacetate = ADP + phosphoenolpyruvate + CO(2)
  • Protein family

  • phosphoenolpyruvate carboxykinase [ATP] family (according to Swiss-Prot) phosphoenolpyruvate carboxykinase [ATP] family
  • [SW|Domains]

  • Nucleotide binding Domain (233–240)
  • Structure

  • [PDB|2PXZ] (''E.coli'')
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot), cytoplasm
  • Expression and Regulation

    Operons

    genes
    [gene|74D4616D1A550D87182FAAC2A4AF6E04F81E1572|pckA]
    description
    [Pubmed|9387221]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15720552], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|CcpN]: repression, [Pubmed|15720552], in [regulon|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|CcpN regulon]
  • regulation

  • repressed by glucose (35-fold) [protein|search|CcpN] [Pubmed|15720552,12850135]
  • view in new tab

    Biological materials

    Mutant

  • 1A1005 ( ''pckA''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A1005&Search=1A1005 BGSC]
  • 1A996 ( ''pckA''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A996&Search=1A996 BGSC]
  • GP1147 (''pckA''::''neo''), available in [SW|Jörg Stülke]'s lab
  • BKE30560 (Δ[gene|74D4616D1A550D87182FAAC2A4AF6E04F81E1572|pckA]::erm trpC2), available at [http://www.bgsc.org/getdetail.php?bgscid=BSU30560 BGSC], upstream reverse: _UP1_CATATGAAACCTTCCTTTAT, downstream forward: _UP4_TAAAAAACAAAAGCCAAGAG
  • BKK30560 (Δ[gene|74D4616D1A550D87182FAAC2A4AF6E04F81E1572|pckA]::kan trpC2), available at [http://www.bgsc.org/getdetail.php?bgscid=BSU30560 BGSC], upstream reverse: _UP1_CATATGAAACCTTCCTTTAT, downstream forward: _UP4_TAAAAAACAAAAGCCAAGAG
  • Expression vector

  • pGP1753 (N-terminal Strep-tag, for [SW|SPINE], purification from ''B. subtilis'', in [SW|pGP380]) (available in [SW|Jörg Stülke]'s lab) [pubmed|20933603]
  • pGP1762 (for expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844], available in [SW|Jörg Stülke]'s lab)
  • pGP1763 (for expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172], available in [SW|Jörg Stülke]'s lab)
  • GFP fusion

  • GP1430 (spc, based on [SW|pGP1870]), available in the [SW|Stülke] lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1129 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab [pubmed|20933603]
  • Antibody

  • **
  • Labs working on this gene/protein

  • [SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
  • References

  • 12850135,15720552,18586936,9387221,20933603,22190493,23136871