SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


HNH nuclease-like protein, rescues [protein|49E8BFEC1CAB77DD91E0ED0791EBD480E4871239|AddA]-[protein|55A1EF8A10CB398CCD3FDD06D9483FE0DCE31C64|AddB]-mediated recombination intermediates
11.31 kDa
protein length
100 aa Sequence Blast
gene length
303 bp Sequence Blast
rescuing of [protein|49E8BFEC1CAB77DD91E0ED0791EBD480E4871239|AddA]-[protein|55A1EF8A10CB398CCD3FDD06D9483FE0DCE31C64|AddB]-mediated recombination intermediates
HNH nuclease-like protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • Gene

    1,148,155 1,148,457

    Phenotypes of a mutant

  • essential, the mutation can be suppressed by second-site mutations in [gene|49E8BFEC1CAB77DD91E0ED0791EBD480E4871239|addA] or [gene|55A1EF8A10CB398CCD3FDD06D9483FE0DCE31C64|addB] [Pubmed|22984257], non-essential according to [Pubmed|28189581]
  • The protein


  • evenly distributed throughout the cytosol in growing cells [Pubmed|22984257]
  • forms a single focus on the nucleoid upon induction of DNA damage [Pubmed|22984257]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7746142], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • regulation

  • positive control by [protein|search|ComK] [Pubmed|7746142]
  • view in new tab

    Biological materials


  • GP3559 (Δ[gene|74E2AB77354355549D14152D3566C9B953A4CB31|hlpB]::kan), available in [SW|Jörg Stülke]'s lab
  • MGNA-A503 (yisB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE10660 ([gene|74E2AB77354355549D14152D3566C9B953A4CB31|hlpB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGCTTTGCCATATCCGCTC, downstream forward: _UP4_TGACTAAAAAGCAGCCCTCT
  • BKK10660 ([gene|74E2AB77354355549D14152D3566C9B953A4CB31|hlpB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGCTTTGCCATATCCGCTC, downstream forward: _UP4_TGACTAAAAAGCAGCCCTCT
  • References

  • 11948146,22984257,22383849,28189581