SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


potassium channel protein (exporter)
37.00 kDa
protein length
328 aa Sequence Blast
gene length
987 bp Sequence Blast
potassium exporter
potassium channel protein

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW|Potassium uptake/ export]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Regulation]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,218,854 3,219,840

    Phenotypes of a mutant

  • reduced [SW|biofilm formation] (can be suppressed by inactivation of ''[gene|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]'') [Pubmed|23737939]
  • The protein


  • contains a [SW|RCK_N domain] (according to [ UniProt])
  • Structure

  • [PDB|3RBZ] (from Methanothermobacter thermautotrophicus, 24% identity)
  • [SW|Localization]

  • inner spore membrane [Pubmed|26731423]
  • Additional information

  • potassium exporter activity of YugO is activated by glutamate limitation via the C-terminal domain [Pubmed|26503040]
  • Expression and Regulation



    regulatory mechanism

  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|23737939], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • regulation

  • repressed by [protein|search|SinR] [Pubmed|23737939]
  • additional information

  • potassium exporter activity of YugO is activated by glutamate limitation via the C-terminal domain [Pubmed|26503040]
  • view in new tab

    Biological materials


  • MGNA-A624 (yugO::erm), available at the [ NBRP B. subtilis, Japan]
  • GP2098 (''yugO''::''ermC''), available in [SW|Jörg Stülke]'s lab [pubmed|28679749]
  • GP2296 (''yugO''::''tet''), available in [SW|Jörg Stülke]'s lab
  • BKE31322 ([gene|752860E73AD1A72D6598F995B80F5B21A77A5CBD|yugO]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGAAATAAATATCCGATTTG, downstream forward: _UP4_GAAACAGATCAATTCCTTGC
  • BKK31322 ([gene|752860E73AD1A72D6598F995B80F5B21A77A5CBD|yugO]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGAAATAAATATCCGATTTG, downstream forward: _UP4_GAAACAGATCAATTCCTTGC
  • FLAG-tag construct

  • GP2442 ''yugO-3xFLAG spc'' (based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References


  • 26503058,27935846,28086088,28622518
  • Original publications

  • 23737939,26503040,26731423,10617203,28086091,28386026