SubtiBank SubtiBank
yugO
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

yugO

potassium channel protein (exporter)
locus
BSU31322
pI
7.00
mw
37.00 kDa
protein length
328 aa Sequence Blast
gene length
984 bp Sequence Blast
function
potassium exporter
product
potassium channel protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW 1.3.1.3|Potassium uptake/ export]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.4|Regulation]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,218,854 → 3,219,840

    Phenotypes of a mutant

  • reduced [SW|biofilm formation] (can be suppressed by inactivation of ''[gene|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]'') [Pubmed|23737939]
  • The protein

    [SW|Domains]

  • contains a [SW|RCK_N domain] (according to [http://www.uniprot.org/uniprot/?query=RCK+N-terminal+domain&sort=score UniProt])
  • [SW|Localization]

  • inner spore membrane [Pubmed|26731423]
  • Additional information

  • potassium exporter activity of YugO is activated by glutamate limitation via the C-terminal domain [Pubmed|26503040]
  • Expression and Regulation

    Operons

    genes
    [gene|C5C72925567927CC177CCAC5369F80D57B9FAB5F|mstX]-[gene|752860E73AD1A72D6598F995B80F5B21A77A5CBD|yugO]
    description
    [Pubmed|23737939]

    regulatory mechanism

  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|23737939], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • regulation

  • repressed by [protein|search|SinR] [Pubmed|23737939]
  • additional information

  • potassium exporter activity of YugO is activated by glutamate limitation via the C-terminal domain [Pubmed|26503040]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A624 (yugO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/624 NBRP B. subtilis, Japan]
  • TMB92 (''yugO''::''tet''), available in [SW|Erhard Bremer]'s and [SW|Jörg Stülke]'s labs
  • GP2098 (Δ''yugO''::''ermC''), available in [SW|Jörg Stülke]'s lab [pubmed|28679749]
  • BKE31322 (Δ[gene|752860E73AD1A72D6598F995B80F5B21A77A5CBD|yugO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31322 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGAAATAAATATCCGATTTG, downstream forward: _UP4_GAAACAGATCAATTCCTTGC
  • BKK31322 (Δ[gene|752860E73AD1A72D6598F995B80F5B21A77A5CBD|yugO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31322 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGAAATAAATATCCGATTTG, downstream forward: _UP4_GAAACAGATCAATTCCTTGC
  • FLAG-tag construct

  • GP2442 ''yugO-3xFLAG spc'' (based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 26503058,27935846,28086088,28622518
  • Original publications

  • 23737939,26503040,26731423,10617203,28086091,28386026