SubtiBank SubtiBank
hemY

hemY

coproporphyrinogen oxidase
locus
BSU_10140
pI
8.04
mw
51.04 kDa
protein length
470 aa Sequence Blast
gene length
1413 bp Sequence Blast
function
biosynthesis of heme
product
coproporphyrinogen oxidase
essential
no
ec
1.3.3.4
synonyms
hemG

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.6|Biosynthesis of heme/ siroheme]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,088,197 1,089,609

    The protein

    Catalyzed reaction/ biological activity

  • coproporphyrinogen --> coproporphyrin [pubmed|25646457]
  • 3 O2 + protoporphyrinogen IX --> 3 H2O2 + protoporphyrin IX (according to UniProt)
  • Protein family

  • Protoporphyrinogen oxidase family (single member, according to UniProt)
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|3I6D]
  • [SW|Localization]

  • cell membrane (peripheral) [pubmed|7928957]
  • Expression and Regulation

    Operons

    genes
    [gene|762E7731EFEAC9F38074D7A7E9A3E5759437CDCA|hemE]-[gene|E4C588EC93132CCBE4F40559F8A480A66A2D82D7|hemH]-[gene|7541AD7D06BC4CE30AD576562E0053CC1E25B4D6|hemY]
    description
    [Pubmed|1459957]
    view in new tab

    Biological materials

    Mutant

  • BKE10140 ([gene|7541AD7D06BC4CE30AD576562E0053CC1E25B4D6|hemY]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCACTCATGTTCATCGCCT, downstream forward: _UP4_TAAAACCTCCGCTTTATCGC
  • BKK10140 ([gene|7541AD7D06BC4CE30AD576562E0053CC1E25B4D6|hemY]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCACTCATGTTCATCGCCT, downstream forward: _UP4_TAAAACCTCCGCTTTATCGC
  • References

    Reviews

  • 28123057
  • Original Publications

  • 9217019,1459957,7928957,19266155,19944166,22273380,25646457,8288631,28739897