SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


coproporphyrinogen oxidase
51.04 kDa
protein length
470 aa Sequence Blast
gene length
1413 bp Sequence Blast
biosynthesis of heme
coproporphyrinogen oxidase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of heme/ siroheme]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,088,197 1,089,609

    The protein

    Catalyzed reaction/ biological activity

  • coproporphyrinogen --> coproporphyrin [pubmed|25646457]
  • 3 O2 + protoporphyrinogen IX --> 3 H2O2 + protoporphyrin IX (according to UniProt)
  • Protein family

  • Protoporphyrinogen oxidase family (single member, according to UniProt)
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|3I6D]
  • [SW|Localization]

  • cell membrane (peripheral) [pubmed|7928957]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE10140 ([gene|7541AD7D06BC4CE30AD576562E0053CC1E25B4D6|hemY]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCACTCATGTTCATCGCCT, downstream forward: _UP4_TAAAACCTCCGCTTTATCGC
  • BKK10140 ([gene|7541AD7D06BC4CE30AD576562E0053CC1E25B4D6|hemY]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTCACTCATGTTCATCGCCT, downstream forward: _UP4_TAAAACCTCCGCTTTATCGC
  • References


  • 28123057
  • Original Publications

  • 9217019,1459957,7928957,19266155,19944166,22273380,25646457,8288631,28739897