SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


anaerobic coproporphyrinogen III oxidase
41.40 kDa
protein length
379 aa Sequence Blast
gene length
1140 bp Sequence Blast
heme biosynthesis
anaerobic coproporphyrinogen III oxidase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of heme/ siroheme]
  • Gene

    2,629,718 2,630,857

    The protein

    Protein family

  • anaerobic coproporphyrinogen-III oxidase family (with [protein|5A1E474D2A6043ACF0DF00FEA7F66BFB1332C691|HemZ], according to UniProt)
  • Paralogous protein(s)

  • [protein|5A1E474D2A6043ACF0DF00FEA7F66BFB1332C691|HemZ]
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • SAM (according to UniProt)
  • Structure

  • [PDB|1OLT] (from E. coli, 26% identity) [pubmed|14633981]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9371469], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • additional information

  • There is a terminator between '[protein|search|lepA]' and '[protein|search|hemN]' with only little readthrough
  • view in new tab

    Biological materials


  • BKE25500 ([gene|757C51296E198849EAC1FFA4D37121D9085930A8|hemN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGGATTCACCTTCTTTA, downstream forward: _UP4_TAATTGACATTTTTCTTGTG
  • BKK25500 ([gene|757C51296E198849EAC1FFA4D37121D9085930A8|hemN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGGATTCACCTTCTTTA, downstream forward: _UP4_TAATTGACATTTTTCTTGTG
  • References

  • 9371469,8757728,10498703,14633981