SubtiBank SubtiBank
hemN

hemN

anaerobic coproporphyrinogen III oxidase
locus
BSU_25500
pI
5.53
mw
41.40 kDa
protein length
379 aa Sequence Blast
gene length
1140 bp Sequence Blast
function
heme biosynthesis
product
anaerobic coproporphyrinogen III oxidase
essential
no
synonyms
yqeR

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.6|Biosynthesis of heme/ siroheme]
  • Gene

    Coordinates
    2,629,718 2,630,857

    The protein

    Protein family

  • anaerobic coproporphyrinogen-III oxidase family (with [protein|5A1E474D2A6043ACF0DF00FEA7F66BFB1332C691|HemZ], according to UniProt)
  • Paralogous protein(s)

  • [protein|5A1E474D2A6043ACF0DF00FEA7F66BFB1332C691|HemZ]
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • SAM (according to UniProt)
  • Structure

  • [PDB|1OLT] (from E. coli, 26% identity) [pubmed|14633981]
  • Expression and Regulation

    Operons

    genes
    [gene|3744083E3BB30A64D15360A12636665F76C40327|lepA]-[gene|757C51296E198849EAC1FFA4D37121D9085930A8|hemN]
    description
    [Pubmed|8757728]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9371469], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • additional information

  • There is a terminator between '[protein|search|lepA]' and '[protein|search|hemN]' with only little readthrough
  • view in new tab

    Biological materials

    Mutant

  • BKE25500 ([gene|757C51296E198849EAC1FFA4D37121D9085930A8|hemN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGGATTCACCTTCTTTA, downstream forward: _UP4_TAATTGACATTTTTCTTGTG
  • BKK25500 ([gene|757C51296E198849EAC1FFA4D37121D9085930A8|hemN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGGATTCACCTTCTTTA, downstream forward: _UP4_TAATTGACATTTTTCTTGTG
  • References

  • 9371469,8757728,10498703,14633981