SubtiBank SubtiBank
levD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

levD

fructose-specific permease of the [SW|phosphotransferase systems|phosphotransferase system], EIIA of the [category|SW 1.2.2|PTS]
locus
BSU_27070
pI
4.48
mw
16.11 kDa
protein length
146 aa Sequence Blast
gene length
441 bp Sequence Blast
function
fructose uptake and phosphorylation
product
fructose-specific [category|SW 1.2.2|PTS], EIIA component
essential
no
ec
2.7.1.69
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.2|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.27|Utilization of other polymeric carbohydrates]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.7|Utilization of fructose]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    2,762,395 2,762,835

    The protein

    Protein family

  • [category|SW 1.2.2|PTS] permease, mannose family [Pubmed|10627040]
  • Structure

  • [PDB|1PDO] (E. coli ManX, 33% identity) [pubmed|8676384]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|75C568C8F6912AC064B8B435975D52510D25466A|levD]-[gene|CAE38D8F25A5EC6AC8045E40072E6FEC632045FA|levE]-[gene|8ABA3735067C7AA433E09F219EE7239196377A95|levF]-[gene|F23B951F60A6A669D5BD86836906E0F4AD7A0C1B|levG]-[gene|61D5B957E018D019AE0CE1D5F6C6A33EF982ED49|sacC]
    description
    [Pubmed|2117666]

    sigma factors

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]: sigma factor, [Pubmed|1924373], in [regulon|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|7592486], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|1D2043CC0D8CF64142F0A5993A936C5A196726D4|LevR]: activation, [Pubmed|1900939], in [regulon|1D2043CC0D8CF64142F0A5993A936C5A196726D4|LevR regulon]
  • regulation

  • induced in the presence of fructose ([protein|search|LevR]) [Pubmed|1900939]
  • view in new tab

    Biological materials

    Mutant

  • BKE27070 ([gene|75C568C8F6912AC064B8B435975D52510D25466A|levD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTATTGCTCCTTTCC, downstream forward: _UP4_GATACAAGAGAGGATGAATT
  • BKK27070 ([gene|75C568C8F6912AC064B8B435975D52510D25466A|levD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTATTGCTCCTTTCC, downstream forward: _UP4_GATACAAGAGAGGATGAATT
  • References

  • 10627040,2117666,1619665,7592487,7592486,9033408,1924373,7592486,1900939,22900538,8676384