SubtiBank SubtiBank
zagA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

zagA

zinc metallochaperone, ZTP activated GTPase A
locus
BSU_03360
pI
4.40
mw
45.15 kDa
protein length
397 aa Sequence Blast
gene length
1194 bp Sequence Blast
function
supply of zinc from [protein|035154A4160F084BA1CC124D0951937B203E167D|RpmE] to [protein|7732A37D59E2643F232F2C0AFE51BCF7A79EDE29|FolE]
product
ZTP activated GTPase A
essential
no
synonyms
yciC

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW 1.3.2.3|Zinc]
  • [category|SW 3|Information processing] → [category|SW 3.5|Targets of second messengers] → [category|SW 3.5.4|Targets of ZTP]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    366,063 367,256

    The protein

    Catalyzed reaction/ biological activity

  • has GTPase and ZTPase activity [pubmed|31132310]
  • mobilization of zinc from [protein|035154A4160F084BA1CC124D0951937B203E167D|RpmE] (after insertion of [protein|DAE7AB27A4C42BF50556BB76F33BEFA8DF35EA3A|RpmEB] into the [SW|ribosome]), to provide it to [protein|7732A37D59E2643F232F2C0AFE51BCF7A79EDE29|FolE] [pubmed|31132310]
  • the interaction with FolE facilitates the supply of zinc to [protein|7732A37D59E2643F232F2C0AFE51BCF7A79EDE29|FolE] under conditions of zinc limitation [pubmed|31132310]
  • Protein family

  • SIMIBI class G3E GTPase family (single member, according to UniProt)
  • Kinetic information

  • KM for GTP: 40 µM [pubmed|31132310]
  • KM for ZTP: 36 µM [pubmed|31132310]
  • [SW|Domains]

  • CobW C-terminal domain (aa 259-374) (according to UniProt)
  • Modification

  • phosphorylated on Arg-58 [Pubmed|22517742]
  • Effectors of protein activity

  • ZTP (stimulates interaction with [protein|7732A37D59E2643F232F2C0AFE51BCF7A79EDE29|FolE]) [https://www.biorxiv.org/content/biorxiv/early/2019/03/31/594382.full.pdf reference]
  • Structure

  • [PDB|1NIJ] (YjiA from E. coli, 27% identity) [pubmed|14696199]
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|F735802BB483C2C5437240AB2E9FC340EAA5B353|yczL]-[gene|75DB07A2704FEC2932BD0CDD24E2B3454E9551E1|zagA]
    description
    [Pubmed|25649915]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12426338], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur]: repression, in the presence of zinc [Pubmed|12426338], in [regulon|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur regulon]
  • view in new tab

    genes
    [gene|93380E8EEB672C14C9BE2B5A6D8573FBCA149514|folEB]-[gene|456AF184261976FAA73359E81443F7035F457D07|yciB]-[gene|F735802BB483C2C5437240AB2E9FC340EAA5B353|yczL]-[gene|75DB07A2704FEC2932BD0CDD24E2B3454E9551E1|zagA]
    description
    [Pubmed|9811636]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12426338], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur]: repression, in the presence of zinc [Pubmed|12426338], in [regulon|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur regulon]
  • regulation

  • [SW|folE2]: induced by zinc starvation ([protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur]) [Pubmed|12426338]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B999 (yciC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1998 NBRP B. subtilis, Japan]
  • BKE03360 ([gene|75DB07A2704FEC2932BD0CDD24E2B3454E9551E1|zagA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATAGTGCCTCCATTAA, downstream forward: _UP4_TAGAAAAAAAGCCGTCCCAT
  • BKK03360 ([gene|75DB07A2704FEC2932BD0CDD24E2B3454E9551E1|zagA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATAGTGCCTCCATTAA, downstream forward: _UP4_TAGAAAAAAAGCCGTCCCAT
  • labs

  • [SW|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
  • References

    Reviews

  • 31220391
  • Original publications

  • 12426338,9811636,18344368,22517742,18763711,23406412,27561249,14696199,31132310