SubtiBank SubtiBank
yisJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yisJ

unknown
locus
BSU_10740
pI
8.05
mw
35.53 kDa
protein length
307 aa Sequence Blast
gene length
924 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • Gene

    Coordinates
    1,151,166 1,152,089

    The protein

    Protein family

  • cotH family (with [protein|D53067098F693669F61E5CCF6C06664580C40C79|CotH], according to UniProt)
  • Structure

  • [PDB|5JD9] (from B. cereus, 28% identity)
  • [SW|Localization]

  • spore wall (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|75FBA935A39AF67DB4E69C8699D29D9F5C149143|yisJ]-[gene|022933D89666CDD2ACE39BCBB78D349BAF8E899B|yisI]
    description
    [Pubmed|22383849]

    regulation

  • induced during [SW|sporulation] [Pubmed|22383849]
  • strongly expressed during oligotrophic growth [pubmed|30792386]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B189 (yisJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1188 NBRP B. subtilis, Japan]
  • BKE10740 ([gene|75FBA935A39AF67DB4E69C8699D29D9F5C149143|yisJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCTTTCCTCCTTCTC, downstream forward: _UP4_TAGTCCTTTCTCCATTAAAA
  • BKK10740 ([gene|75FBA935A39AF67DB4E69C8699D29D9F5C149143|yisJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCTTTCCTCCTTCTC, downstream forward: _UP4_TAGTCCTTTCTCCATTAAAA
  • References

    Research papers

  • 30792386