SubtiBank SubtiBank
ydaS
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydaS

general stress protein
locus
BSU_04370
pI
12.19
mw
8.51 kDa
protein length
gene length
258 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    Coordinates
    492,654 492,911

    The protein

    Protein family

  • UPF0410 family (with [protein|050A2F1399C2B0831A24623867875BFEBD02AA71|YwzA], according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|7601A53CE6A8AD417AADBED3199DB46B285D9059|ydaS]
    description
    [Pubmed|10482513]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|10482513], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    genes
    [gene|E30C92E8D0CC56F7406B87B7EA25B7C41086DD73|ydaT]-[gene|7601A53CE6A8AD417AADBED3199DB46B285D9059|ydaS]
    description
    [Pubmed|10482513]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|10482513], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C112 (ydaS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2110 NBRP B. subtilis, Japan]
  • BKE04370 ([gene|7601A53CE6A8AD417AADBED3199DB46B285D9059|ydaS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATGATCACCTCTCATA, downstream forward: _UP4_TAGACTCATTAGATACAGGA
  • BKK04370 ([gene|7601A53CE6A8AD417AADBED3199DB46B285D9059|ydaS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATGATCACCTCTCATA, downstream forward: _UP4_TAGACTCATTAGATACAGGA
  • References

  • 15805528,10482513