SubtiBank SubtiBank
gmuC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gmuC

glucomannan-specific permease of the [SW|phosphotransferase systems|phosphotransferase system], EIIC of the [category|SW 1.2.2|PTS]
locus
BSU_05830
pI
9.80
mw
48.27 kDa
protein length
442 aa Sequence Blast
gene length
1329 bp Sequence Blast
function
glucomannan uptake and phosphorylation
product
glucomannan-specific lichenan-specific [category|SW 1.2.2|PTS], EIIC component
essential
no
synonyms
ydhO

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW 1.2.2.2|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.25|Utilization of glucomannan]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • Gene

    Coordinates
    627,284 628,612

    The protein

    Protein family

  • [category|SW 1.2.2|PTS] permease, lactose family [Pubmed|10627040]
  • Paralogous protein(s)

  • [protein|83A7C160B0301A2B51B65478D99ACB753D67AF74|LicC], [protein|0650C9EAB395EB6ABDADBE72F0DA9F8E5E606B0E|YwbA]
  • Structure

  • [PDB|3QNQ] (EIIC component of diacetylchitobiose specific PTS from ''Bacillus cereus''; 41% identity, 80% similarity) [Pubmed|21471968]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|00A4A90685CED4AD46829C45718CF26F1D62F5D3|gmuB]-[gene|44014896157718D3A6190DFDBD663C5CB9DA63FC|gmuA]-[gene|76324E0A6CAA8E1DD0B0C6FAE1CAB402231BF7CC|gmuC]-[gene|D8C81A8768E9C6B47B5E196B54DC2A3A8256E7E6|gmuD]-[gene|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|gmuR]-[gene|EB6DE119E6FB18413DB2C2B62B114FB787164F74|gmuE]-[gene|35225776F6044513D3E77DBBD6A7A8FE976F506A|gmuF]-[gene|289ACC9D13BBFAA5C083EE525ECCC32DB06E075F|gmuG]
    description
    [Pubmed|18177310]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|18177310], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR]: repression, [Pubmed|18177310], in [regulon|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|18177310], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by cellobiose ([protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR]) [Pubmed|18177310]
  • view in new tab

    additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials

    Mutant

  • MGNA-C190 (ydhO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2188 NBRP B. subtilis, Japan]
  • BKE05830 ([gene|76324E0A6CAA8E1DD0B0C6FAE1CAB402231BF7CC|gmuC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAACACCCTATCCACCCCGA, downstream forward: _UP4_ATGTGACATAAGGGGAGAGA
  • BKK05830 ([gene|76324E0A6CAA8E1DD0B0C6FAE1CAB402231BF7CC|gmuC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAACACCCTATCCACCCCGA, downstream forward: _UP4_ATGTGACATAAGGGGAGAGA
  • References

  • 18177310,10627040,20817675,21471968