SubtiBank SubtiBank
dacB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

dacB

sporulation-specific penicillin-binding protein 5*, D-alanyl-D-alanine carboxypeptidase
locus
BSU_23190
pI
9.73
mw
42.92 kDa
protein length
382 aa Sequence Blast
gene length
1149 bp Sequence Blast
function
carboxypeptidase
product
penicillin-binding protein 5*, D-alanyl-D-alanine carboxypeptidase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.7|Penicillin-binding proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,423,383 2,424,531

    Phenotypes of a mutant

  • inactivation of ''[gene|76825D77907E8CE47B17ED56D7E2A348B1ADA5EC|dacB]'' reduces sporulation efficiency to 19.3% that of wild type cells [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • modifies degree of cross-linking of glycan strands in peptidoglycan
  • Protein family

  • [SW|Peptidase S11 family] (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|F7AD78F9AB98A150E8CDFC1D01A9F938FF9F8BD1|DacF]
  • Structure

  • [PDB|3MFD] (beta-lactamase superfamily domain)
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|76825D77907E8CE47B17ED56D7E2A348B1ADA5EC|dacB]-[gene|F00DAFFBB136F9331C47D45BF44DC59E3EBB75FA|spmA]-[gene|6AFED2DBF443D3E7FECE211BF8FCF1FD33B7104D|spmB]
    description
    [Pubmed|7642500]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,7528199], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|15699190,7528199]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A098 (dacB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/98 NBRP B. subtilis, Japan]
  • 1A744 ( ''dacB''::''cat''), [Pubmed|1644769], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A744&Search=1A744 BGSC]
  • 1A745 ( ''dacB''::''cat''), [Pubmed|1644769], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A745&Search=1A745 BGSC]
  • BKE23190 ([gene|76825D77907E8CE47B17ED56D7E2A348B1ADA5EC|dacB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTGCTCACGTCCTTG, downstream forward: _UP4_CTGAATGCGGCAGGCGGAGC
  • BKK23190 ([gene|76825D77907E8CE47B17ED56D7E2A348B1ADA5EC|dacB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTGCTCACGTCCTTG, downstream forward: _UP4_CTGAATGCGGCAGGCGGAGC
  • References

    Reviews

  • 18266855
  • Original publications

  • 10498740,9864321,1548223,7642500,19542328,7528199,15699190,22123250,26735940