SubtiBank SubtiBank
araE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

araE

L-arabinose permease (proton symporter)
locus
BSU_33960
pI
9.26
mw
50.25 kDa
protein length
464 aa Sequence Blast
gene length
1395 bp Sequence Blast
function
uptake of arabinose, galactose and xylose
product
L-arabinose permease
essential
no
synonyms
yvbR

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.3|Carbohydrate transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.6|Utilization of arabinan/ arabinose/ arabitol]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,484,072 3,485,466

    The protein

    Catalyzed reaction/ biological activity

  • transports arabinose, and also xylose and galactose [Pubmed|9620981]
  • Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Sugar transporter (TC 2.A.1.1) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|7CE5A42042E5D52768735E795DB805530691D8A6|YwtG], [protein|8B0701B5694ABA8142476CB896E590FE1981D7DB|YfiG], [protein|A84AC4E40E7C722E27AE9C24ACECFEABD51B57BE|YncC], [protein|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|CsbC], [protein|4A77316AA94F9C11DB70AB76711AACBD28098AA1|IolT]
  • Structure

  • [PDB|4JA4] (the xylose transporter XylE from ''E. coli'', 39% identity, 68% similarity) [Pubmed|23624861]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|770D9A5BEEEABE9C3FC772E74001329206ECFAB3|araE]
    description
    [Pubmed|9401028]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9401028], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12949161], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|A567466894AE9DE7CDE7816615433A37532297B5|AraR]: repression, [Pubmed|9401028,9620981,10417639], in [regulon|A567466894AE9DE7CDE7816615433A37532297B5|AraR regulon]
  • regulation

  • induced by arabinose ([protein|search|AraR]) [Pubmed|9401028,9620981,10417639]
  • view in new tab

    Biological materials

    Mutant

  • BKE33960 ([gene|770D9A5BEEEABE9C3FC772E74001329206ECFAB3|araE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCCTGCCCTCCCGAA, downstream forward: _UP4_TGAAAACGCTTTAATGAAAC
  • BKK33960 ([gene|770D9A5BEEEABE9C3FC772E74001329206ECFAB3|araE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCCTGCCCTCCCGAA, downstream forward: _UP4_TGAAAACGCTTTAATGAAAC
  • References

  • 9401028,9620981,23624861,10417639,9620981,12949161