SubtiBank SubtiBank
yhcB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhcB

similar to oxidoreductase
locus
BSU_09020
pI
4.64
mw
18.87 kDa
protein length
176 aa Sequence Blast
gene length
531 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    979,396 979,926

    The protein

    Structure

  • [PDB|4LA4] (from Pseudomonas sp., 34% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|EDDD61CF725449E57C72F63D378F6CD1FAC49ADA|yhbI]-[gene|211C58A92BA2A06A34B1F73BDB68A0F581B942C2|yhbJ]-[gene|93159DC7D5C42CFA54F66F232D73F38957243AB7|yhcA]-[gene|7797B0B66922D51B9D142DD2E5857836E47F015B|yhcB]-[gene|95EED3A91483502CA78067421F678B1EDB965B18|yhcC]
    description
    [Pubmed|22383849]

    additional information

  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] (the half-life of the mRNA increases from 4 to 41 min) [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B472 (yhcB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1471 NBRP B. subtilis, Japan]
  • BKE09020 ([gene|7797B0B66922D51B9D142DD2E5857836E47F015B|yhcB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAGGAAACCTCCCTGT, downstream forward: _UP4_GCAGGACAGTAAGGAGAGGT
  • BKK09020 ([gene|7797B0B66922D51B9D142DD2E5857836E47F015B|yhcB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAGGAAACCTCCCTGT, downstream forward: _UP4_GCAGGACAGTAAGGAGAGGT
  • References

  • 21815947