SubtiBank SubtiBank
yjfC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yjfC

unknown
locus
BSU_12130
pI
5.82
mw
35.14 kDa
protein length
299 aa Sequence Blast
gene length
900 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,283,463 1,284,362

    Biological materials

    Mutant

  • MGNA-A351 (yjfC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/351 NBRP B. subtilis, Japan]
  • BKE12130 ([gene|77A86837F8DB3BD71232F4118A68E586B4345BEE|yjfC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTGATTCCCTCCTTGT, downstream forward: _UP4_CTGTTTTCTACATGAAAAAA
  • BKK12130 ([gene|77A86837F8DB3BD71232F4118A68E586B4345BEE|yjfC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTGATTCCCTCCTTGT, downstream forward: _UP4_CTGTTTTCTACATGAAAAAA