SubtiBank SubtiBank
rbsR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rbsR

transcriptional repressor of the ribose operon
locus
BSU_35910
pI
5.58
mw
35.70 kDa
protein length
326 aa Sequence Blast
gene length
981 bp Sequence Blast
function
regulation of ribose utilization
product
transcriptional repressor ([SW|LacI family])
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.4|Utilization of ribose]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    3,701,411 3,702,391

    The protein

    Protein family

  • [SW|LacI family]
  • Structure

  • [PDB|3CTP] (from Alkaliphilus metalliredigens, 35% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|77AEAC0F06B4D5F062D4A2740794B7BFDDA31096|rbsR]-[gene|C229BD2C00B169CF4A99482E65B3F749AD9D51D8|rbsK]-[gene|F0E6F191FAF8F279462B09BF1FE4C6C752A57803|rbsD]-[gene|AB4A686F62550F90F5BD8D27DAADC9C33F1DA1DB|rbsA]-[gene|F1258E31151E137A850811B0C851D473CEFFD43B|rbsC]-[gene|1D67888E79B09956F9258F4068546D8C67103549|rbsB]
    description
    [Pubmed|7921236]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7511775], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|7921236], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|7592460], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed upon transition into the stationary phase ([protein|search|AbrB]) [Pubmed|7592460]
  • view in new tab

    Biological materials

    Mutant

  • BKE35910 ([gene|77AEAC0F06B4D5F062D4A2740794B7BFDDA31096|rbsR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAACAGCTCCTCCTTGTT, downstream forward: _UP4_AAGACGACAAGAAAGGAAGA
  • BKK35910 ([gene|77AEAC0F06B4D5F062D4A2740794B7BFDDA31096|rbsR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAACAGCTCCTCCTTGTT, downstream forward: _UP4_AAGACGACAAGAAAGGAAGA
  • References

  • 16872404,16519689,22900538,7592460,12850135,7921236,7511775